def estMaxSequence(self, filename):
print("Reading testing data from %s" % (filename))
# Read in the testing dta from the file
self.dataset = DataSet(filename)
self.dataset.readFile(200, "test")
# Run Viterbi to estimate most likely sequence
viterbi = Viterbi(self.hmm)
self.maxSequence = viterbi.mostLikelySequence(self.dataset.testOutput)
def estMaxSequence(self, filename):
print "Reading testing data from %s" % (filename)
# Read in the testing dta from the file
dataset = DataSet(filename)
states, obs = dataset.read_file()
# Run Viterbi to estimate most likely sequence
viterbi = Viterbi(self.hmm)
for idx in range(len(obs)):
self.maxSequence.append(viterbi.mostLikelySequence(obs[idx]))
self.realStates.append(states[idx])
def predict_tag(tags, vocab, A, B):
# Reading the test data and preprocessing it (prep is the word list with empty line marked by <n>)
test_file = Config.TEST
original, prep = read_preprocess_test_data(vocab, test_file)
# Decodes the sequence using Viterbi algorithm and returns optimal predicted tag sequences for each of the sentences
decoder = Viterbi.Viterbi(vocab, tags, prep, A, B)
predicted_tags = decoder.decode()
tagged = []
for word, tag in zip(original, predicted_tags):
tagged.append((word, tag))
# writing the output into a file (location output/test_out.tt)
out_file = Config.TEST_OUT
with open(out_file, 'w', encoding='utf-8') as out:
for word, tag in tagged:
if not word:
out.write("\n")
else:
out.write("{0}\t{1}\n".format(word, tag))
out.close()
def Decode(self):
if self.Nodes==[] or self.Edges==None:
print("No graph for decoding")
return []
else:
self.cls=[]
self.cls=Viterbi.Viterbi([self.Edges]*(len(self.Nodes)-1),copy.copy(self.Nodes))
return self.cls
def _findPath(self, sequence):
"""Calls the C extension to calculate the most likely sequence of
states that would generate the given sequence."""
symbols = sorted(set(sequence))
seq = self._sequenceToInts(symbols, sequence)
ems = self._setupEmissions(symbols)
del(sequence); del(symbols)
return Viterbi.findPath(list(seq), ems, self.columnProbs)
def _findPath(self, sequence):
"""Calls the C extension to calculate the most likely sequence of
states that would generate the given sequence."""
symbols = sorted(set(sequence))
seq = self._sequenceToInts(symbols, sequence)
ems = self._setupEmissions(symbols)
del (sequence)
del (symbols)
return Viterbi.findPath(list(seq), ems, self.columnProbs)
def findingHiddenStates(sentences):
foundHiddenWords = []
f = open("compFile.txt",
"w+") # Opening File pointer to store the joined lines
for line in sentences:
# S
f.write(line)
foundHiddenWords.append(Viterbi.viterbiAlgorithm(line.decode('utf-8')))
for hiddenWord in foundHiddenWords:
print hiddenWord
return foundHiddenWords
def Decode(self):
if self.Edges == None:
print("No graph for decoding")
elif self.Nodes == []:
return []
elif len(self.Nodes) == 1:
return self.Nodes[0].index(max(self.Nodes[0]))
else:
self.cls = []
self.cls = Viterbi.Viterbi([self.Edges] * (len(self.Nodes) - 1),
copy.copy(self.Nodes))
return self.cls
def getParametrs(dirPath, test):
seqList = getParssedData(dirPath)
e, segLen = createEmission(seqList)
pAlpha = [0.86, 0.89]
pBeta = [0.89, 0.78]
tau = createTransition(seqList, pAlpha, pBeta) # todo change to real vals
buildHistogrem(seqList)
testseqList = getParssedData(test)
print testseqList[0][0]
# newTau = tau
# newTau[1,1] -= 0.1
# newTau[1,0] += 0.1
#
for i in range(100):
cur_seq = testseqList[i][0]
seq_viterbi = vt.viterbi_round(e, tau, cur_seq)
seq_fb = fb.fb_round(e, tau, cur_seq)
print("viterbi\t" + seq_viterbi)
print("fd \t" + seq_fb[2])
print("real\t" + testseqList[i][1])
# print("seq\t\t" + testseqList[i][0])
return testseqList, seqList, e, tau
# for i in range(91, 300):
# print(i)
# cur_seq = seqList[i][0]
# seq_viterbi = vt.viterbi_round(e, tau, cur_seq)
# seq_fb = fb.fb_round(e, tau, cur_seq)
#
# print("viterbi \n", seq_viterbi)
# print("forward backward\n", seq_fb)
# print("real\n", seqList[i][1])
# print(segLen)
def runNaive(ObsMat, kmer_size, num_state, event_data_test, write_fasta):
kmer_map, inv_kmer_map = Util.getKmerMap(kmer_size)
total_acc = 0.0
T = 0.0
for event in event_data_test:
currentSeq, state_label = DataInput.getData_event(event, kmer_map)
t = len(currentSeq)
Vit = Viterbi.Viterbi([], ObsMat, num_state, t, kmer_size)
Y_hat, seq_est = Vit.decodeNaive(currentSeq)
Y_test = np.array(state_label).reshape(-1, 1)
acc = float(np.sum(Y_hat == Y_test)) / t
total_acc += float(np.sum(Y_hat == Y_test))
T += t
print("Accuracy = %f" % acc)
if write_fasta == 1:
write_to_file(seq_est, T, kmer_size)
# print(seq_est)
total_acc /= T
print("Total Accuracy = %f" % total_acc)
def perform_prediction(data_to_predict, e, tau, test):
final_predictions, final_errors = [], []
viterbi_errors, fb_errors, fb_penalties = [], [], []
viterbi_wins = 0
fb_wins = 0
for data in data_to_predict:
seq = data[SEQ]
# train: predict the secondary structure using viterbi and posterior
viterbi_structure = Viterbi.viterbi_round(e, tau, seq)
f, b, fb_structure = fb.fb_round(e, tau, seq)
# find error in v and p
cur_viterbi_error = calc_error(viterbi_structure, data[SOL])
viterbi_errors.append(cur_viterbi_error)
cur_fb_error = calc_error(fb_structure, data[SOL])
fb_errors.append(cur_fb_error)
# choose the path with the smallest error
if (cur_viterbi_error < cur_fb_error):
final_predictions.append((seq, viterbi_structure))
final_errors.append(cur_viterbi_error)
viterbi_wins += 1
else:
final_predictions.append((seq, fb_structure))
fb_wins += 1
final_errors.append(cur_fb_error)
# calc the posterior
s1, s2, s3 = posterior_table(f, b)
# calc the penalties on the posterior (for the graph later that tomi wanted)
fb_penalties.append(
calc_fb_penalty([s1[1:], s2[1:], s3[1:]], data[SOL]))
if test:
# plot the probability for each state to emit E, H, ot O
plot_structures_probability(s1[1:], s2[1:], s3[1:], len(seq))
# plot viterbi vs. posterior by error percentage
data_size = len(data_to_predict)
print(data_size)
v_total_wins = float(viterbi_wins) / float(data_size)
fb_total_wins = 1 - v_total_wins
plot_error_analysis(viterbi_errors, fb_errors, v_total_wins, fb_total_wins)
def viterbiAlgorithm(seq, a, e):
"""Run the Viterbi algorithm and saves the Viterbi Matrix and the Back Trace Matrix in an output folder.
"""
# Read the A and E matrices
AEMatrices.init(e, a)
# Read the input sequence(s) and store them into setX
setX = Sequences.readSeq(seq, "X")
# Perform the Viterbi algorithm on the first sequence of the set setX
# and store the viterbi matrix in the variable vi and the back trace matrix in variable backTrace
(vi, backTrace, probability) = Viterbi.viterbi(setX[0])
# Print the output matrices of Viterbi algorithm
Viterbi.writePathMatrix(vi, setX[0], "output/ViterbiMatrix.tsv")
Viterbi.writePathMatrix(backTrace, setX[0], "output/BackTraceMatrix.tsv")
#Print the vitervi path instead of the vitervi backtrace
with open('ViterbiPath.txt', 'w') as text_file:
print('Path: {}.'.format(Viterbi.generateStateSeq(backTrace, setX[0])),
file=text_file)
# Print the most likely sequence path of x according to the viterbi algorithm
print('Most likely state is {0}, with probability of {1}'.format(
''.join(Viterbi.generateStateSeq(backTrace, setX[0])), probability))
for seq in ["aactgcacatgcggcgcgcccgcgctaat", "gggcgcgggcgccccgcg"]:
# NB. Book and Lio's notes use integrated transition and initial
# distribution matrix (initial step is transition from dummy state 0)
# This is confusing, so I will separate them out.
# Wiki has non-integrated Viterbi algorithm implementation
# 1.1. Implement Forward algorithm
fwd = Forward(TransitionP, EmissionP, InitialP)
p = fwd.prob(seq)
print "**************************************"
print "Probability of", seq, ":", p
print "Log probability:", -log(p)
print "**************************************"
# 1.2. Implement Viterbi algorithm
vtb = Viterbi(TransitionP, EmissionP, InitialP)
(prob, path) = vtb.maxSeq(seq)
print "**************************************"
print "Viterbi path:"
print "P =", prob
print seq
print ''.join(str(i) for i in path)
print "**************************************"
# 1.3. Length distribution
# Suppose we have a string of only G-C (with equal emission probili-
# ties for each state).
# Once HMM enters state 1 (detect G-C islands), modify the probability
# of going out of this state to 1/200, and staying to 199/200. Then on
# average HMM will stay in that state for 200 characters.
for seq in ["aactgcacatgcggcgcgcccgcgctaat", "gggcgcgggcgccccgcg"]:
# NB. Book and Lio's notes use integrated transition and initial
# distribution matrix (initial step is transition from dummy state 0)
# This is confusing, so I will separate them out.
# Wiki has non-integrated Viterbi algorithm implementation
# 1.1. Implement Forward algorithm
fwd = Forward(TransitionP, EmissionP, InitialP)
p = fwd.prob(seq)
print "**************************************"
print "Probability of", seq, ":", p
print "Log probability:", -log(p)
print "**************************************"
# 1.2. Implement Viterbi algorithm
vtb = Viterbi(TransitionP, EmissionP, InitialP)
(prob, path) = vtb.maxSeq(seq)
print "**************************************"
print "Viterbi path:"
print "P =", prob
print seq
print "".join(str(i) for i in path)
print "**************************************"
# 1.3. Length distribution
# Suppose we have a string of only G-C (with equal emission probili-
# ties for each state).
# Once HMM enters state 1 (detect G-C islands), modify the probability
# of going out of this state to 1/200, and staying to 199/200. Then on
# average HMM will stay in that state for 200 characters.
print("P0 + P1 + P2 = %0.8f" % (P0 + P1 + P2))
print(25 * "-")
P0 = H.calculate(a={L + 1: 0}, signal=S)
P1 = H.calculate(a={L + 1: 1}, signal=S)
P2 = H.calculate(a={L + 1: 2}, signal=S)
print("P0 = P(x%s=0 | S%s) = %0.8f" % (L + 1, L, P0))
print("P1 = P(x%s=1 | S%s) = %0.8f" % (L + 1, L, P1))
print("P2 = P(x%s=2 | S%s) = %0.8f" % (L + 1, L, P2))
print("")
print("P0 + P1 + P2 = %0.8f" % (P0 + P1 + P2))
print(25 * "-")
P0 = H.calculate(a={L + 1: 0}, signal=S, ameans='signal')
P1 = H.calculate(a={L + 1: 1}, signal=S, ameans='signal')
P2 = H.calculate(a={L + 1: 2}, signal=S, ameans='signal')
print("P0 = P(s%s=0 | S%s) = %0.8f" % (L + 1, L, P0))
print("P1 = P(s%s=1 | S%s) = %0.8f" % (L + 1, L, P1))
print("P2 = P(s%s=2 | S%s) = %0.8f" % (L + 1, L, P2))
print("")
print("P0 + P1 + P2 = %0.8f" % (P0 + P1 + P2))
print(25 * "-")
print("P(S%s) = %0.8f" % (L, H.calculate(signal=S)))
# Viterbi
print(25 * "-")
print("Viterbi algorithm")
X, P = v.viterbi(A, B, p, S)
print("Argmax P(X | S) = ", X, ". P = %0.8f" % P)
u"αββαααβα": u"AHAAAHAA"
}
states = (u'α', u'β')
observations = ('A', 'H', 'H', 'A', 'A')
start_probability = HMM.start_P(dna, states)
transition_probability = HMM.transition_P(dna, states)
emission_probability = HMM.emission_P(dna, states)
posteriors = ForwardBackward.forward_backward(observations, states,
start_probability,
transition_probability,
emission_probability)
viterbi = Viterbi.viterbi(observations, states, start_probability,
transition_probability, emission_probability)
print 'Probabilities:'
print start_probability
print transition_probability
print emission_probability
print 'Posteriors:'
for line in posteriors:
print u'α: ' + str("%.4f" % line[u'α']) + u' ' + u'β: ' + str(
"%.4f" % line[u'β'])
print 'Viterbi:'
for item in viterbi[1]:
print item,
HMM.array_A[line_state[j]][line_state[j+1]] += 1 #array_A计算状态转移概率
for p in range(len(line_state)):
HMM.count_dic[line_state[p]] += 1 # 记录每一个状态的出现次数
for state in HMM.STATES:
if word_list[p] not in HMM.array_B[state]:
HMM.array_B[state][word_list[p]] = 0.0 #保证每个字都在STATES的字典中
# if word_list[p] not in array_B[line_state[p]]:
# # print(word_list[p])
# array_B[line_state[p]][word_list[p]] = 0
# else:
HMM.array_B[line_state[p]][word_list[p]] += 1 # array_B用于计算发射概率
HMM.Prob_Array() #对概率取对数保证精度
output = ''
for line in testSet:
line = line.strip()
tag = Viterbi.Viterbi(line, HMM.array_Pi, HMM.array_A, HMM.array_B)
# print(tag)
seg = wordSplit.tag_seg(line, tag)
# print(seg)
list = ''
for i in range(len(seg)):
list = list + seg[i] + ' '
# print(list)
output = output + list + '\n'
print(output)
outputfile = open('output.txt', mode='w', encoding='utf-8')
outputfile.write(output)
#calculate state and path probabilities
for i in range(0, self.len_a):
# Smoothing to prevent divide by zero error
if (0 in self.paths[i]):
self.paths[i] = [a + 1 for a in self.paths[i]]
sum_paths = self.paths[i].sum()
if (0 in self.states[i]):
self.states[i] = [a + 1 for a in self.states[i]]
sum_states = self.states[i].sum()
for j in range(0, self.len_a):
self.prob_paths[i][j] = float(self.paths[i][j]) / sum_paths
self.prob_states[i][j] = float(self.states[i][j]) / sum_states
#percentage corruption:
percentages = [0.1, 0.2]
#create wordcorrector class object
wc = WordCorrector()
#call model
for percent in percentages:
print "Results for corruption percentage: ", percent
wc.construct_HMM(percent)
#create viterbi object
viterbi = Viterbi.Viterbi(wc.prob_states, wc.prob_paths, wc.c_test_data)
#invoke the execution process of viterbi
viterbi.parse_data(wc.test_data)
viterbi.calc_precision_recall()
if (0 in self.Eis[i]):
self.Eis[i] = [x + 1 for x in self.Eis[i]]
sum = self.Eis[i].sum()
# print self.alphabets[i], sum
for j in range(0, len(self.alphabets)):
self.probEis[i][j] = float(self.Eis[i][j]) / sum
def getEmissionProbabilities(self):
return self.probEis
def getTransitionProbabilities(self):
return self.probAij
def trainHMModel(self):
self.splitDocument()
# Corrupt the text splited for training set and test set
self.corruptedTrainingSet = self.corruptText(self.trainingSet, True)
# Calculate the probability for transition from state i to state j
self.corruptedTestSet = self.corruptText(self.testSet, False)
self.probabilityAij()
self.probabilityEmission()
objSC = SpellingCorrection()
objSC.trainHMModel()
objViterbi = Viterbi.Viterbi(objSC.getEmissionProbabilities(),
objSC.getTransitionProbabilities(),
objSC.corruptedTestSet)
objViterbi.process(objSC.testSet)
tran.append(temp)
# Calculate Start Bit Probability
for i in range(16):
s_sum = 0
for j in range(SEQS):
if (rx[j][0] == i):
s_sum += 1
s_bits[i] = s_sum/SEQS
# Calculate State Transition Probabilities
for i in range(l-1):
for j in range(SEQS):
a = rx[j][i]
b = rx[j][i+1]
tran[i][a][b] += round(1/SEQS,6)
## Find most probable path
# Find the most probable starting path
mx = max(s_bits)
start = 0
for i in range(len(s_bits)):
if (s_bits[i] == mx):
start = i
path = Viterbi.viterbi_pathfind(rx,1)
print('-'*(l+2) + '\n' + '-'*(l+2))
print(' Result: ' + arr_2_hex(path))
print('Original: ' + arr_2_hex(seq))
class ProcessingFile:
# Reading PrideAndPrejudiceChapter3.txt and storing each of its line
# into a list(sentences)
fp = open("PrideAndPrejudiceChapter3.txt")
sentences = fp.readlines()
# Joins the extracted words and inserts spaces at
# the correct locations.
# Writes the formatted text into an output file
# after the output is encoded into UTF8 format
f = open("opFile.txt", "w+")
for line in HiddenStates.findingHiddenStates(FormatText.removeSpaces(sentences)):
for x in line[0]:
utf8string = x.encode("UTF-8")
if utf8string == "." or utf8string == "," or utf8string == "-" \
or utf8string == '"':
f.seek(-1, os.SEEK_CUR)
elif utf8string == "\n":
f.write(utf8string)
continue
f.write(utf8string + " ")
# Comparing the original text with the original using the proposed comparison
# technique
ratio = FormatText.percentageMatching(FormatText.getOriginalText(sentences),
FormatText.getOriginalText(sentences))
# Reading the output file
opFile = open("opFile.txt")
sentences2 = opFile.readlines()
# Checking the percentage accuracy of our output file after applying Viterbi
ratio2 = FormatText.percentageMatching(FormatText.getOriginalText(sentences),
FormatText.getOriginalText(sentences2))
# Check the accuracy ratio of the output file versus original text
# considering the cosine similarity of the words in the original text
cosSimilarity = accuracyChecks.cosineSimilarity\
('PrideAndPrejudiceChapter3.txt', 'opFile.txt')
# Returns the ratio of the spaces wrong placed in the output file
# to the placement of spaces in the original text
spacesError = accuracyChecks.calculateSpaces\
('PrideAndPrejudiceChapter3.txt', 'opFile.txt')
print "---=-=-=-=-=-=-=-=-=--=-=-=-=-=-=-=---"
print 'ratiocheck : ', ratio
print 'ratiocheck2 : ', ratio2
print 'cosine similarity : ', cosSimilarity
print 'spaces error percentage : ', spacesError
applyVertibi2 = Viterbi.viterbiAlgorithm('Iamfast')
applyVertibi3 = Viterbi.viterbiAlgorithm('Letusmeetafternoon')
# applyVertibi = Viterbi.viterbi_segment('itseasyformetosplitlongruntogetherblocks')
#
# print applyVertibi
print applyVertibi3
# print Virtebi.word_prob("therefore")
# print Virtebi.word_prob("attacked")
# print Virtebi.word_prob("proudest")
# print len(Virtebi.dictionary)
# print applyVertibi3
import numpy as np
import math
import copy
from Viterbi import *
network_type = 'original'
predictions = './predictions/prediction_' + network_type + '_prob.csv'
actual = './predictions/actual_' + network_type + '_prob.csv'
states = [
'WALKING', 'RUNNING', 'STAIRS (UP)', 'STAIRS (DOWN)', 'STANDING',
'SITTING', 'LYING', 'BENDING', 'CYCLING (SITTING)', 'CYCLING (STANDING)'
]
numOfAct = len(states)
v = Viterbi(states)
v.load_observations(predictions)
actual_labels = v.load_actual_labels(actual)
v.generate_start_probability(numOfAct)
#transMatrix={'STANDING': {'STANDING': 82.0, 'BENDING': 3.0, 'WALKING': 7.0, 'CYCLING (SITTING)': 1.0, 'SITTING': 1.0, 'CYCLING (STANDING)': 1.0, 'RUNNING': 2.0, 'STAIRS (UP)': 1.0, 'STAIRS (DOWN)': 1.0, 'LYING': 1.0},
# 'BENDING': {'STANDING': 23.0, 'BENDING': 69.0, 'WALKING': 1.0, 'CYCLING (SITTING)': 1.0, 'SITTING': 1.0, 'CYCLING (STANDING)': 1.0, 'RUNNING': 1.0, 'STAIRS (UP)': 1.0, 'STAIRS (DOWN)': 1.0, 'LYING': 1.0},
# 'WALKING': {'STANDING': 14.0, 'BENDING': 1.0, 'WALKING': 78.0, 'CYCLING (SITTING)': 1.0, 'SITTING': 1.0, 'CYCLING (STANDING)': 1.0, 'RUNNING': 1.0, 'STAIRS (UP)': 1.0, 'STAIRS (DOWN)': 1.0, 'LYING': 1.0},
# 'CYCLING (SITTING)': {'STANDING': 1.0, 'BENDING': 1.0, 'WALKING':1.0, 'CYCLING (SITTING)': 89.0, 'SITTING': 3.0, 'CYCLING (STANDING)': 1.0, 'RUNNING': 1.0, 'STAIRS (UP)': 1.0, 'STAIRS (DOWN)': 1.0, 'LYING': 1.0},
# 'SITTING': {'STANDING': 1.0, 'BENDING': 1.0, 'WALKING': 1.0, 'CYCLING (SITTING)': 1.0, 'SITTING': 91.0, 'CYCLING (STANDING)': 1.0, 'RUNNING': 1.0, 'STAIRS (UP)': 1.0, 'STAIRS (DOWN)': 1.0, 'LYING': 1.0},
# 'CYCLING (STANDING)': {'STANDING': 1.0, 'BENDING': 1.0, 'WALKING': 1.0, 'CYCLING (SITTING)': 1.0, 'SITTING': 1.0, 'CYCLING (STANDING)': 91.0, 'RUNNING': 1.0, 'STAIRS (UP)': 1.0, 'STAIRS (DOWN)': 1.0, 'LYING': 1.0},
# 'RUNNING': {'STANDING': 2.0, 'BENDING': 1.0, 'WALKING': 6.0, 'CYCLING (SITTING)': 1.0, 'SITTING': 1.0, 'CYCLING (STANDING)': 1.0, 'RUNNING': 85.0, 'STAIRS (UP)': 1.0, 'STAIRS (DOWN)': 1.0, 'LYING': 1.0},
# 'STAIRS (UP)': {'STANDING': 1.0, 'BENDING': 1.0, 'WALKING': 1.0, 'CYCLING (SITTING)': 1.0, 'SITTING': 1.0, 'CYCLING (STANDING)': 1.0, 'RUNNING': 1.0, 'STAIRS (UP)': 91.0, 'STAIRS (DOWN)': 1.0, 'LYING': 1.0},
# 'STAIRS (DOWN)': {'STANDING': 1.0, 'BENDING': 1.0, 'WALKING': 1.0, 'CYCLING (SITTING)': 1.0, 'SITTING': 1.0, 'CYCLING (STANDING)': 1.0, 'RUNNING': 1.0, 'STAIRS (UP)': 1.0, 'STAIRS (DOWN)': 91.0, 'LYING': 1.0},
# 'LYING': {'STANDING': 1.0, 'BENDING': 1.0, 'WALKING': 1.0, 'CYCLING (SITTING)': 1.0, 'SITTING': 1.0, 'CYCLING (STANDING)': 1.0, 'RUNNING': 1.0, 'STAIRS (UP)': 1.0, 'STAIRS (DOWN)': 1.0, 'LYING': 91.0}}
states = [
"WALKING",
"RUNNING",
"STAIRS (UP)",
"STAIRS (DOWN)",
"STANDING",
"SITTING",
"LYING",
"BENDING",
"CYCLING (SITTING)",
"CYCLING (STANDING)",
]
numOfAct = len(states)
v = Viterbi(states)
v.load_observations(predictions)
actual_labels = v.load_actual_labels(actual)
v.generate_start_probability(numOfAct)
# transMatrix={'STANDING': {'STANDING': 82.0, 'BENDING': 3.0, 'WALKING': 7.0, 'CYCLING (SITTING)': 1.0, 'SITTING': 1.0, 'CYCLING (STANDING)': 1.0, 'RUNNING': 2.0, 'STAIRS (UP)': 1.0, 'STAIRS (DOWN)': 1.0, 'LYING': 1.0},
# 'BENDING': {'STANDING': 23.0, 'BENDING': 69.0, 'WALKING': 1.0, 'CYCLING (SITTING)': 1.0, 'SITTING': 1.0, 'CYCLING (STANDING)': 1.0, 'RUNNING': 1.0, 'STAIRS (UP)': 1.0, 'STAIRS (DOWN)': 1.0, 'LYING': 1.0},
# 'WALKING': {'STANDING': 14.0, 'BENDING': 1.0, 'WALKING': 78.0, 'CYCLING (SITTING)': 1.0, 'SITTING': 1.0, 'CYCLING (STANDING)': 1.0, 'RUNNING': 1.0, 'STAIRS (UP)': 1.0, 'STAIRS (DOWN)': 1.0, 'LYING': 1.0},
# 'CYCLING (SITTING)': {'STANDING': 1.0, 'BENDING': 1.0, 'WALKING':1.0, 'CYCLING (SITTING)': 89.0, 'SITTING': 3.0, 'CYCLING (STANDING)': 1.0, 'RUNNING': 1.0, 'STAIRS (UP)': 1.0, 'STAIRS (DOWN)': 1.0, 'LYING': 1.0},
# 'SITTING': {'STANDING': 1.0, 'BENDING': 1.0, 'WALKING': 1.0, 'CYCLING (SITTING)': 1.0, 'SITTING': 91.0, 'CYCLING (STANDING)': 1.0, 'RUNNING': 1.0, 'STAIRS (UP)': 1.0, 'STAIRS (DOWN)': 1.0, 'LYING': 1.0},
# 'CYCLING (STANDING)': {'STANDING': 1.0, 'BENDING': 1.0, 'WALKING': 1.0, 'CYCLING (SITTING)': 1.0, 'SITTING': 1.0, 'CYCLING (STANDING)': 91.0, 'RUNNING': 1.0, 'STAIRS (UP)': 1.0, 'STAIRS (DOWN)': 1.0, 'LYING': 1.0},
# 'RUNNING': {'STANDING': 2.0, 'BENDING': 1.0, 'WALKING': 6.0, 'CYCLING (SITTING)': 1.0, 'SITTING': 1.0, 'CYCLING (STANDING)': 1.0, 'RUNNING': 85.0, 'STAIRS (UP)': 1.0, 'STAIRS (DOWN)': 1.0, 'LYING': 1.0},
# 'STAIRS (UP)': {'STANDING': 1.0, 'BENDING': 1.0, 'WALKING': 1.0, 'CYCLING (SITTING)': 1.0, 'SITTING': 1.0, 'CYCLING (STANDING)': 1.0, 'RUNNING': 1.0, 'STAIRS (UP)': 91.0, 'STAIRS (DOWN)': 1.0, 'LYING': 1.0},
# 'STAIRS (DOWN)': {'STANDING': 1.0, 'BENDING': 1.0, 'WALKING': 1.0, 'CYCLING (SITTING)': 1.0, 'SITTING': 1.0, 'CYCLING (STANDING)': 1.0, 'RUNNING': 1.0, 'STAIRS (UP)': 1.0, 'STAIRS (DOWN)': 91.0, 'LYING': 1.0},
# 'LYING': {'STANDING': 1.0, 'BENDING': 1.0, 'WALKING': 1.0, 'CYCLING (SITTING)': 1.0, 'SITTING': 1.0, 'CYCLING (STANDING)': 1.0, 'RUNNING': 1.0, 'STAIRS (UP)': 1.0, 'STAIRS (DOWN)': 1.0, 'LYING': 91.0}}