def test_equals_true(self):
"""Tests the equality operator"""
location1 = st.Location("contig", 1, 2, True)
location2 = st.Location("contig", 1, 2, True)
self.assertTrue(location1 == location1)
self.assertTrue(location1 == location2)
def test_equals_false(self):
"""Tests the equality operator"""
location1 = st.Location("contig1", 1, 2, True)
location2 = st.Location("contig1", 1, 2, False)
location3 = st.Location("contig2", 1, 2, True)
self.assertFalse(location1 == location2)
self.assertFalse(location1 == location3)
def test_init_genome(self):
"""Tests the init_genome() method"""
organism = self.organism
scan_seqs = organism.sequences_for_genes_scan(['VNG12345G'],
seqtype='upstream')
self.assertEquals(
(st.Location('NC_000915.1', -128, 152,
False), 'ACGTTTAAAAGAGAGAGAGACACAGTATATATTTTTTTAAAA'),
scan_seqs['NP_206803.1'])
search_seqs = organism.sequences_for_genes_search(['VNG12345G'],
seqtype='upstream')
self.assertEquals(
(st.Location('NC_000915.1', -28, 142,
False), 'ACGTTTAAAAGAGAGAGAGACACAGTATATATTTTTTTAAAA'),
search_seqs['NP_206803.1'])
def test_make_edges_from_predictions(self):
"""tests the make_edges_from_predictions function"""
predictions = [('gene1', 'gene2'), ('gene2', 'gene3')]
organism = MockOrganism(
'64091', {
'gene1':
st.Feature('feature1', 'typ1', 'feature_name1',
st.Location('contig1', 24, 89, False)),
'gene2':
st.Feature('feature2', 'typ1', 'feature_name2',
st.Location('contig1', 15, 21, False)),
'gene3':
st.Feature('feature3', 'typ2', 'feature_name3',
st.Location('contig1', 100, 154, False))
})
edges = mo.make_pairs_from_predictions(predictions, organism)
self.assertEquals([('gene2', 'gene1'), ('gene2', 'gene2'),
('gene2', 'gene3')], edges)
def test_make_operon_edges_forward(self):
"""test when all genes of the operon are on the forward strand"""
operon = ['gene1', 'gene2', 'gene3']
features = {
'gene1':
st.Feature('feature1', 'typ1', 'feature_name1',
st.Location('contig1', 24, 89, False)),
'gene2':
st.Feature('feature2', 'typ1', 'feature_name2',
st.Location('contig1', 15, 21, False)),
'gene3':
st.Feature('feature3', 'typ2', 'feature_name3',
st.Location('contig1', 100, 154, False))
}
edges = mo.make_operon_pairs(operon, features)
self.assertTrue(('gene2', 'gene1') in edges)
self.assertTrue(('gene2', 'gene2') in edges)
self.assertTrue(('gene2', 'gene3') in edges)
self.assertEqual(3, len(edges))
def __make_organism(self):
"""makes a mock organism with almost real data"""
features = {}
dfile = util.read_dfile('testdata/Halobacterium_sp_features',
comment='--')
for line in dfile.lines:
features[line[0]] = st.Feature(
line[0], line[1], line[2],
st.Location(line[3], int(line[4]), int(line[5]),
line[6] == 'R'))
tfile = util.read_dfile('testdata/Halobacterium_sp_feature_names',
comment='--')
synonyms = th.create_from_rsat_feature_names(tfile)
return MockOrganismWithSynonyms('64091', features, synonyms)
def read_feature(line):
"""Creates and adds a feature and associated contig from current
DelimitedFile line"""
contig = line[3]
is_reverse = False
if line[6] == 'R':
is_reverse = True
# note that feature positions can sometimes start with a '>'
# or '<', so make sure it is stripped away
return st.Feature(
line[0], line[1], line[2],
st.Location(contig, int(line[4].lstrip('<>')),
int(line[5].lstrip('<>')), is_reverse))
def test_get_network_factory(self):
"""test happy path"""
microbes_online = MockMicrobesOnline('testdata/gnc64091.named')
network = mo.get_network_factory(microbes_online, 20, 123)(
MockOrganism(
'64091', {
'gene1':
st.Feature('feature1', 'typ1', 'feature_name1',
st.Location('contig1', 24, 89, False)),
'gene2':
st.Feature('feature2', 'typ1', 'feature_name2',
st.Location('contig1', 15, 21, False)),
'gene3':
st.Feature('feature3', 'typ2', 'feature_name3',
st.Location('contig1', 100, 154, False))
}, {
'gene1': 'gene1',
'gene2': 'gene2',
'gene3': 'gene3'
}),
check_size=False)
self.assertEquals(3, network.num_edges())
self.assertEquals(6000, network.total_score())
self.assertEquals(123, network.weight)
def seqs_for(self, gene_aliases, distances):
def seq2str(seq):
return str(seq.upper()).replace('X', 'N')
synonyms = self.organism.thesaurus()
if self.seqmap is None:
self.seqmap = {synonyms[r.id]: r for r in self.fasta_records if r.id in synonyms}
result = {}
for gene in gene_aliases:
if gene in synonyms and synonyms[gene] in self.seqmap:
fasta_record = self.seqmap[synonyms[gene]]
result[synonyms[gene]] = (st.Location('', 0, 0, False),
seq2str(fasta_record.seq.upper()))
else:
logging.warn("'%s' not in the sequences !!!!", gene)
return result