Exemplo n.º 1
0
    def _create_particles_and_constraints(self) -> None:
        for name, segment in TURKEY_SEGMENTS.items():
            # scale the points up.
            scaled_points = np.asarray(segment, float) * self.scale
            self.segments[name] = []
            for p in scaled_points:
                # find the particle if it already exists, otherwise create a new one.
                particle: Particle = next((part for part in self.particles
                                           if np.allclose(part.curr_pos, p)),
                                          Particle(position=p,
                                                   mass=Turkey.mass))
                if particle not in self.particles:
                    self.particles.append(particle)
                # print("adding a new particle at ", particle.curr_pos)
                # print(len(self.particles))
                # append the particle to this segment.
                self.segments[name].append(particle)

            if name == "eye":
                continue

            # create a Stick constraint for each pair within this segment.
            for p1, p2 in pairs(self.segments[name]):
                constraint = StickConstraint(p1, p2, relatice_tolerance=0.1)
                self.stick_constraints.append(constraint)

            # add more flexible stick constraints between every other node on this segment:
            for p1, p2 in pairs(self.segments[name][::2]):
                constraint = StickConstraint(p1, p2, relatice_tolerance=0.4)
                self.stick_constraints.append(constraint)
def num_inflection_points(ys):
    ysp = [y2 - y1 for y1,y2 in pairs(ys)]
    yspp = [y2 - y1 for y1,y2 in pairs(ysp)]
    sign_changes = 0
    for y1,y2 in pairs(yspp):
        if y1*y2 < 0:
            sign_changes += 1
    return sign_changes
Exemplo n.º 3
0
def hamiltonian(config):
    """Given a configuration describing the left-endpoints of tfs, compute
    associated energy"""
    poses = positions(config)
    total_site_energy = sum(score_seq(energy_matrix,genome[pos:pos+w])
                            for pos in poses)
    total_interaction_energy = interaction_energy * len([(i,j) for (i,j) in pairs(poses) if j - i == w])
    total_exclusion_energy = exclusion_energy * len([(i,j) for (i,j) in pairs(poses) if j - i < w])
    return total_site_energy + total_interaction_energy + total_exclusion_energy
Exemplo n.º 4
0
def estimate_drift_diffusion(xs):
    """Given a sample path Xt, estimate mu, sigma for:
    dX = mu + sigma dW"""
    dxs = [x1-x0 for (x0,x1) in pairs(xs)]
    mu = mean(dxs)
    sigma = sd(dxs)
    return mu,sigma
Exemplo n.º 5
0
    def encode_exactly_one(self, variables):
        # at least one
        self._add_clause(*variables)

        # at most one
        for v1, v2 in pairs(variables):
            self._add_clause(-v1, -v2)
Exemplo n.º 6
0
def ordered_fast_1d_haar_transform(signal):
    """
    Calculate the (ordered) 1D Haar transform of a signal.

    Notes
    -----
    - Copies the signal before operating on it.
    - Be sure to invert it using the ordered algorithm.
    - If the signal is not length power of two, it will be zero padded.

    """
    # Set up overhead variables
    s = zero_pad(signal)
    num_sweeps = int(log(len(s), 2))
    a = s.copy()
    new_a = s.copy()

    for _ in range(num_sweeps):
        calculations = [((first + second) / 2, (first - second) / 2)
                        for first, second in pairs(new_a)]
        new_a, c = zip(*calculations)
        new_a = np.array(new_a)
        c = np.array(c)
        # New signal is [a, c]
        a[:len(new_a)] = new_a[:]
        a[len(new_a):len(new_a) + len(c)] = c[:]

    return a
Exemplo n.º 7
0
def make_ringer_viterbi2(code, L=L):
    """Make ringer using viterbi algorithm"""
    def aa_mu(aa):
        return mean([code[aa, b1, b2] for b1, b2 in nuc_pairs])

    def aa_sigma(aa):
        return sqrt(variance([code[aa, b1, b2] for b1, b2 in nuc_pairs]))

    etas = []
    #etas.append({x3:min(code[aa,x1,x3] for x1 in nucs for aa in aas) for x3 in nucs})
    etas.append({
        x3: min(code[aa, x1, x3] - aa_mu(aa) + (aa_sigma(aa)**2) / 2.0
                for x1 in nucs for aa in aas)
        for x3 in nucs
    })
    for i in range(1, L):
        d = {
            xnp1: min(code[aa, xn, xnp1] + etas[i - 1][xn] for xn in nucs
                      for aa in aas)
            for xnp1 in nucs
        }
        etas.append(d)
    binding_site = "".join([min(nucs, key=lambda n: eta[n]) for eta in etas])
    sites = [binding_site for i in range(n)]
    bd = [
        min(aas,
            key=lambda aa: code[aa, n1, n2] - aa_mu(aa) +
            (aa_sigma(aa)**2) / 2.0) for n1, n2 in pairs(binding_site)
    ]
    return bd, sites
Exemplo n.º 8
0
def valid(xs,sigma):
    """
    Determine whether configuration is valid
    """
    ys = sorted(xs)
    return (all(xp - x >= 2*sigma for (x,xp) in pairs(ys)) and
            ys[0] > sigma and ys[-1] < 1 - sigma)
Exemplo n.º 9
0
def acceptance_ratio(sample):
    ars = [0.0]
    acceptances = 0.0
    for n,(x,y) in enumerate(pairs(sample)):
        if x != y:
            acceptances += 1
        ars.append(acceptances/(n+1))
    return ars
Exemplo n.º 10
0
def new_from_image():
    """Create a new deck from an uploaded image
    """
    log_request(request)
    data = request.json

    if not valid_params(['username', 'deck_name', 'description', 'session_id', 'name', 'divs'], data):
        logging.debug("Missing parameters")
        return jsonify({'error' : 500})
        
    username = data['username']
    deckname = data['deck_name']
    desc     = data['description']
    sId      = data['session_id']

    filename = data['name']
    
    uId = user.get_uId(username)
    
    if not user.verify(username, sId):
        return jsonify({'error' : 101})
        
    if not filename or not os.path.exists("/var/www/resources/tmp/{0}".format(filename)):
        return jsonify({'error' : 201})
        
    # create the new deck in the database
    dId, deck_id = deck.new(deckname, uId, desc)

    # split the temp image
    i = Image.open("/var/www/resources/tmp/{0}".format(filename))
    imgs = splitImage(i, data['divs'])

    for row in imgs:
        # pairwise collect the cards
        img_pairs =  pairs(row)
        for p in img_pairs:
            cId = card.new(dId, "", "")
            # String IO for file in memory
            atmp = StringIO()
            p[0].convert("RGB").save(atmp, format="JPEG")
            atmp.seek(0)
            a_id = resource.new(atmp, id_generator() + ".jpg", cId)[1]
            sideA = '<img src="[FLASHYRESOURCE:{0}]" />'.format(a_id)

            if p[1] != None:
                btmp = StringIO()
                p[1].convert("RGB").save(btmp, format="JPEG")
                btmp.seek(0)
                b_id = resource.new(btmp, id_generator() + ".jpg", cId)[1]
                sideB = '<img src="[FLASHYRESOURCE:{0}]" />'.format(b_id)
            else:
                sideB = '[FLASHYRESOURCE:00000000]'
                
            card.modify(cId, sideA, sideB)

    os.unlink("/var/www/resources/tmp/{0}".format(filename))        # let the filesystem delete the temp file
    d = deck.get_deck(dId);
    return jsonify({'deck': d, 'error': 0})
Exemplo n.º 11
0
    def __draw_data(self, painter):
        painter.setPen(self.__look.data_pen)

        points_adjuster = utils.QtPointsAdjuster(self.__drawing_area_rect,
                                                 self.__model.bounding_rect)
        qpoints = (QPoint(*points_adjuster.adjust(point))
                   for point in self.__model.points)
        for qpoint1, qpoint2 in utils.pairs(qpoints):
            painter.drawLine(qpoint1, qpoint2)
Exemplo n.º 12
0
Arquivo: hmm.py Projeto: poneill/amic
def estimate_a01(hidden_states):
    n = d = 0
    for hs1,hs2 in pairs(hidden_states):
            if hs1 == 0:
                d += 1
                if hs2 == 1:
                    n += 1
    a01 = n/float(d) if d > 0 else 0
    return a01
Exemplo n.º 13
0
def chip_ref(G,config,mean_frag_length):
    """Given a genome length G, configuration (vector giving
    locations of left endpoints of TFs), and mean fragment length,
    return a collection of fragments (in form [left endpoint, right
    endpoint)) for one cell."""
    lamb = 1.0/mean_frag_length
    splits = make_splits(G,lamb)
    all_endpoints = pairs(splits)
    bound_fragments = [(lep,rep) for (lep,rep) in all_endpoints if any(lep <= pos < rep for pos in config)]
    return bound_fragments
Exemplo n.º 14
0
 def _get_order(self, vars):
     num_nodes = self.encoder.num_nodes
     position = {node: 0 for node in range(num_nodes)}
     for u, v in pairs(range(num_nodes)):
         var = vars[u][v]
         if var in self.model:
             position[v] += 1
         else:
             position[u] += 1
     ordering = posdict_to_ordering(position)
     return [self.encoder.node_reverse_lookup[i] for i in ordering]
Exemplo n.º 15
0
    def encode(self):
        # allow at most one arc (redundant, not strictly necessary, speeds up encoding)
        for i,j in pairs(range(self.num_nodes)):
            _i, _j = self.node_reverse_lookup[i], self.node_reverse_lookup[j]
            self._add_comment(f"at most one arc {_i}->{_j} or {_j}->{_i}")
            self._add_clause(-self.arc[i][j], -self.arc[j][i])

        self.encode_bn()

        # setup graph variables for treewidth computation
        self.encode_tw()

        super().encode()
Exemplo n.º 16
0
 def get_triangulated(self):
     graph = nx.DiGraph()
     elim_order = self.get_elim_order()
     # add nodes
     graph.add_nodes_from(elim_order)
     # add edges
     for _u, _v in pairs(elim_order):
         u = self.encoder.node_lookup[_u]
         v = self.encoder.node_lookup[_v]
         # only consider arc if it obeys elim order
         if self.encoder.arc[u][v] in self.model:
             graph.add_edge(_u, _v)
     return graph
Exemplo n.º 17
0
 def __init__(self):
     super().__init__()
     for p1, p2 in pairs(mountain_points):
         bottom_left = (p1[0], GROUND_Y)
         bottom_right = (p2[0], GROUND_Y)
         points_list = [
             bottom_left,
             p1,
             p2,
             bottom_right,
         ]
         # each "segment" of the mountain is a convex polygon.
         self.append(
             arcade.create_polygon(points_list, arcade.color.BROWN_NOSE))
Exemplo n.º 18
0
    def encode_tw(self):
        data = self.data
        for _v in data:
            v = self.node_lookup[_v]
            for p, score in data[_v].items():
                for _u in p:
                    u = self.node_lookup.get(_u)
                    if u is None: continue  # external vertex, ignore
                    # clause: if par and ord then arc
                    self._add_comment(f"par({_v}, {set(p)}) and ord*({_u},{_v}) => arc({_u},{_v})")
                    self._add_clause(-self.par[v][p], -self._ord(u, v), self.arc[u][v])
                    self._add_comment(f"par({_v}, {set(p)}) and ord*({_v},{_u}) => arc({_v},{_u})")
                    self._add_clause(-self.par[v][p], -self._ord(v, u), self.arc[v][u])

                self._add_comment(f"begin moralization of parent {set(p)} of {v}")
                for _u, _w in pairs(p):
                    u, w = self.node_lookup.get(_u), self.node_lookup.get(_w)
                    if u is None or w is None: continue  # external vertices, ignore
                    # clause: moralization (arc between common parents)
                    self._add_comment(f"par({_v}, {set(p)} and ord*({_u},{_w}) => arc({_u},{_w})")
                    self._add_clause(-self.par[v][p], -self._ord(u, w), self.arc[u][w])
                    self._add_comment(f"par({_v}, {set(p)} and ord*({_w},{_u}) => arc({_w},{_u})")
                    self._add_clause(-self.par[v][p], -self._ord(w, u), self.arc[w][u])
                self._add_comment(f"end moralization of parent {set(p)} of {v}")

        # slim only
        for _, bag in self.forced_cliques.items():
            if len(bag) <= 1: continue  # nothing to encode
            self._add_comment(f"begin [slim] forced clique {set(bag)}")
            for _u, _v in pairs(bag):
                u, v = self.node_lookup[_u], self.node_lookup[_v]
                # slim-clause: ord* => arc for nodes in same boundary bag
                self._add_comment(f"\t {_u} before {_v} implies {_u}->{_v}")
                self._add_clause(-self._ord(u, v), self.arc[u][v])
                self._add_comment(f"\t {_v} before {_u} implies {_v}->{_u}")
                self._add_clause(-self._ord(v, u), self.arc[v][u])
            self._add_comment(f"end [slim] forced clique {set(bag)}")
Exemplo n.º 19
0
def handle_acyclicity(bn: BayesianNetwork,
                      seen: set,
                      leaf_nodes: set,
                      debug=False):
    dag = bn.dag
    subdag = nx.subgraph_view(dag, lambda x: True,
                              lambda x, y: not ((x in seen) and (y in seen)))
    forced_arcs = []
    for src, dest in pairs(leaf_nodes):
        if nx.has_path(subdag, src, dest):
            forced_arcs.append((src, dest))
            if debug: print(f"added forced {src}->{dest}")
        else:
            # only check if prev path not found
            if nx.has_path(subdag, dest, src):
                forced_arcs.append((dest, src))
                if debug: print(f"added forced {dest}->{src}")
    return forced_arcs
Exemplo n.º 20
0
def explore_dft():
    """illustrate an example of the detailed fluctuation theorem"""
    K = 3
    fs = np.random.random(K)
    mus = random_stochastic_matrix(K)
    A = np.diag(fs).dot(mus)
    M = infinitesimal_generator_from_rate_matrix(A)
    v = largest_eigenvector(A)
    #path = [0] + [random.randrange(K) for i in xrange(100000)]
    N = 10000
    acc = 0
    for trial in xrange(N):
        path = random_walk(A)
        sigma = sum(log(M[j, i] / M[i, j]) for i, j in pairs(path))
        i_final = -log(v[path[-1]])
        acc += exp(sigma - i_final)
        print trial, -sigma, i_final, acc / float(trial + 1)
    return acc / float(N)
Exemplo n.º 21
0
def make_ringer_viterbi(code, L=L):
    """Make ringer using viterbi algorithm"""
    etas = []
    etas.append({
        x3: min(code[aa, x1, x3] for x1 in nucs for aa in aas)
        for x3 in nucs
    })
    for i in range(1, L):
        d = {
            xnp1: min(code[aa, xn, xnp1] + etas[i - 1][xn] for xn in nucs
                      for aa in aas)
            for xnp1 in nucs
        }
        etas.append(d)
    binding_site = "".join([min(nucs, key=lambda n: eta[n]) for eta in etas])
    sites = [binding_site for i in range(n)]
    bd = [
        min(aas, key=lambda aa: code[aa, n1, n2])
        for n1, n2 in pairs(binding_site)
    ]
    return bd, sites
Exemplo n.º 22
0
def parse_containers(containers):
    # Parse an AirAsia price container and returns a list of flights
    for container in containers:
        rows = container.findAll(
            'tr', {'class': ['fare-light-row', 'fare-dark-row']})
        list_of_flights = []
        for row in rows:
            rowOfFare = row.findAll(
                'tr', {'class': ['fare-light-row', 'fare-dark-row']})
            trip = {}
            if len(rowOfFare) > 0:
                flights = row.findAll('td', {'class': 'avail-table-detail'})
                for depart, arrive in pairs(flights):
                    d, a = trim(depart.getText()), trim(arrive.getText())
                    flight = {'origin': f'{d}', 'destination': f'{a}'}
                    trip.setdefault('flights', []).append(flight)
                price = row.findAll(
                    'div', {'class': 'avail-fare-price'})[0].getText()
                trip['price'] = trim(price)
                list_of_flights.append(trip)
        yield list_of_flights
Exemplo n.º 23
0
def bd_variance(code, bd):
    mean_fs = [mean(code[aa, x, y] for (x, y) in nuc_pairs) for aa in bd]
    mean_sq_fs = [mean(code[aa, x, y]**2 for (x, y) in nuc_pairs) for aa in bd]
    mean_di_fs = [
        2 * mean(code[aa1, x, y] * code[aa2, y, z] for (x, y, z) in nuc_trips)
        for (aa1, aa2) in pairs(bd)
    ]
    higher_terms = [
        f1 * f2 for i, f1 in enumerate(mean_fs) for j, f2 in enumerate(mean_fs)
        if abs(i - j) > 1
    ]
    # print len(mean_sq_fs + mean_di_fs + higher_terms),len(bd)**2
    # print len(mean_sq_fs), len(mean_di_fs), len(higher_terms)
    # print [(i,j) for i,aa1 in enumerate(bd)
    #               for j,aa2 in enumerate(bd) if abs(j-i) == 1]
    # print [(i,j) for i,f1 in enumerate(mean_fs) for j,f2 in enumerate(mean_fs) if abs(i-j) > 1]
    print len(mean_sq_fs), 2 * len(mean_di_fs), len(higher_terms)
    eps_sq = sum(mean_sq_fs) + sum(mean_di_fs) + sum(higher_terms)
    print "eps_sq:", bd_eps_sq_ref(code, bd), eps_sq
    bd_mean_sq = bd_mean(code, bd)**2
    print "bd_mean_sq:", bd_mean_sq
    return eps_sq - bd_mean_sq
Exemplo n.º 24
0
def mean_field_hs(Vs, K):
    """

    Pj(xj) = 1/Z0 *exp(-beta*hj(xj)), where
    hj(xj) = \sum_{<j,jp>} \sum_{xjp \in jp} V(xj,xjp)*Pjp(xjp)

    We assume a Potts model of m variables x0...xj...xm-1 where each
    variable can take on K states 0...i...K-1.  Mean field functions h
    are represented as a matrix hss where each row gives the values
    hj(i).  [Note that i,j are reversed from the usual row-column
    convention.]

    Input is a matrix Vs of pairwise contributions to the hamiltonian
    where Vs[j][jp] is a function V(xj,xjp)
    """
    M = len(Vs)
    jpairs = pairs(range(M))
    hs = [[1 for i in range(K)] for j in range(M)]

    def Pj(xj, j):
        # print xj,j
        return exp(-beta * hs[j][xj]) / sum(exp(-beta * hs[j][xjp]) for xjp in range(K))

    old_hs = matcopy(hs)
    while True:
        for j in range(M):
            for i in range(K):
                hs[j][i] = sum(sum(Vs[j][jp](i, ip) * Pj(ip, jp) for ip in range(K)) for jp in range(j + 1, M)) + sum(
                    sum(Vs[jp][j](ip, i) * Pj(ip, jp) for ip in range(K)) for jp in range(0, j - 1)
                )
        print l2(concat(hs), concat(old_hs))
        if old_hs == hs:
            break
        else:
            old_hs = matcopy(hs)
            print hs
    return hs
Exemplo n.º 25
0
def main_example():
    sequence="""CGAAAAAACGCGAAAAAACGCGAAAAAACGCGAAAAAACGCGAAAAAACGCG
AAAAAACGCGAAAAAACGCGAAAAAACGCGAAAAAACGCGAAAAAACGCGAAAAAACGCGAAAAAA
CGCGAAAAAACGCGAAAAAACG""".replace("\n","")
    lookup = functionify_model(aawedge)
    rise = 3.38 #Angstroms, from Gohlke
    b0 = transpose([[0,0,0]])
    v0 = transpose([[0,0,rise]])
    bs = [b0]
    vs = [v0]
    for pair in pairs(sequence):
        dinuc = "".join(pair)
        params = lookup(dinuc)
        ro, ti, tw = params["roll"],params["tilt"],params["twist"]
        last_b = bs[-1]
        last_v = vs[-1]
        new_v = reduce(matrix_mult,[roll_matrix(ro),
                                    tilt_matrix(ti),
                                    twist_matrix(tw),
                                    last_v])
        new_b = matrix_add(last_b,new_v)
        bs.append(new_b)
        vs.append(new_v)
    return bs
def retrieve_cycles_info(GI):
    cycles = [tuple(c) for c in nx.simple_cycles(GI)
              ]  # Convert cycle to tuple to be able to use them as key
    cycles_info = []

    # Cycles are found as sequence of nodes, all possible edge combination
    # must be found for each cycle. The sign of each cycle do not depend on
    # the edges however.
    for cycle in cycles:
        paths = [[]]
        sign = 1
        for p in pairs(cycle):
            for k, path in enumerate(paths):
                # Replace each path/sign by a list of possible path/sign
                paths[k] = [path + [R] for R in GI.edges[p]["reactions"]]

            sign *= GI.edges[p]["sign"]

            # Flatten the lists
            paths = list(chain.from_iterable(paths))

        cycles_info.append(dict(cycle=cycle, paths=paths, sign=sign))

    return cycles_info
Exemplo n.º 27
0
    def addgeometry(self):
        #initialization
        s = QSettings()
        if self.useactivelayer:
            vectorlayer = self.iface.activeLayer()
        else:
            oldValidation = s.value("/Projections/defaultBehaviour", "useProject")
            s.setValue("/Projections/defaultBehaviour", "useProject")
            vectorlayer=QgsVectorLayer("LineString", "tmp_plot", "memory")
            s.setValue("/Projections/defaultBehaviour", oldValidation)



        # if magnetic heading chosen, assure we have a declination angle
        if (self.pluginGui.radioButton_magNorth.isChecked())  and (str(self.pluginGui.lineEdit_magNorth.text()) == ''):   #magnetic headings
            self.say("No magnetic declination value entered.")
            return 0

        #Get starting point coordinates
        X0 = float(str(self.pluginGui.lineEdit_vertexX0.text()))
        Y0 = float(str(self.pluginGui.lineEdit_vertexY0.text()))
        Z0 = float(str(self.pluginGui.lineEdit_vertexZ0.text()))

        #check if the starting point is specified
        if (X0 == 0 and Y0 == 0 and Z0 == 90):
            self.say("You must supply a starting point.")
            return 0

        # Check if there are any segments
        if (self.pluginGui.table_segmentList.rowCount() < 1):
            self.say("You must enter at least one segment.")
            return 0

        if (self.pluginGui.radioButton_radialSurvey.isChecked()):
            surveytype='radial'
        elif (self.pluginGui.radioButton_boundarySurvey.isChecked()):
            surveytype = 'polygonal'

        arcpoint_count = self.pluginGui.spin_arclines.value()

        def get_points(surveytype):
            """
            Return a list of calculated points for the full run.
            :param surveytype:
            :return:
            """
            vlist = []
            vlist.append(utils.Point(X0, Y0, Z0))
            # convert segment list to set of vertice
            for i in range(self.pluginGui.table_segmentList.rowCount()):
                az = str(self.pluginGui.table_segmentList.item(i, 0).text())
                dis = float(str(self.pluginGui.table_segmentList.item(i, 1).text()))
                zen = str(self.pluginGui.table_segmentList.item(i, 2).text())
                direction = str(self.pluginGui.table_segmentList.item(i, 4).text())
                direction = utils.Direction.resolve(direction)

                try:
                    radius = float(self.pluginGui.table_segmentList.item(i, 3).text())
                except ValueError:
                    radius = None

                if (self.pluginGui.radioButton_englishUnits.isChecked()):
                    # adjust for input in feet, not meters
                    dis = float(dis) / 3.281

                #checking degree input
                if (self.pluginGui.radioButton_azimuthAngle.isChecked()):
                    az = float(self.dmsToDd(az))
                    zen = float(self.dmsToDd(zen))
                elif (self.pluginGui.radioButton_bearingAngle.isChecked()):
                    az = float(self.bearingToDd(az))
                    zen = float(self.bearingToDd(zen))

                #correct for magnetic compass headings if necessary
                if (self.pluginGui.radioButton_defaultNorth.isChecked()):
                    self.magDev = 0.0
                elif (self.pluginGui.radioButton_magNorth.isChecked()):
                    self.magDev = float(self.dmsToDd(str(self.pluginGui.lineEdit_magNorth.text())))
                az = float(az) + float(self.magDev)

                #correct for angles outside of 0.0-360.0
                while (az > 360.0):
                    az = az - 360.0
                while (az < 0.0):
                    az = az + 360.0

                # checking survey type
                if surveytype == 'radial':
                    reference_point = vlist[0]  # reference first vertex

                if surveytype == 'polygonal':
                    reference_point = vlist[-1]  #reference previous vertex

                nextpoint = utils.nextvertex(reference_point, dis, az, zen)
                log(nextpoint)
                log(reference_point)

                if radius:
                    # If there is a radius then we are drawing a arc.
                    # Calculate the arc points.
                    points = list(utils.arc_points(reference_point, nextpoint, dis, radius,
                                                   point_count=arcpoint_count,
                                                   direction=direction))

                    if direction == utils.Direction.ANTICLOCKWISE:
                        points = reversed(points)

                    # Append them to the final points list.
                    vlist.extend(points)

                vlist.append(nextpoint)

            return vlist

        #reprojecting to projects SRS
        points = get_points(surveytype)
        vlist = self.reproject(points, vectorlayer)

        as_segments = self.pluginGui.checkBox_asSegments.isChecked()

        def createpoints(points):
            for point in points:
                geom = QgsGeometry.fromPoint(point)
                feature = QgsFeature()
                feature.setGeometry(geom)
                yield feature

        def createline(points):
            """
            Creata a line feature from a list of points
            :param points: List of QgsPoints
            """
            geom = QgsGeometry.fromPolyline(points)
            feature = QgsFeature()
            feature.setGeometry(geom)
            return feature

        def createpolygon(polygon):
            """
            Create a polygon from a list of points
            :param points: List of QgsPoints
            """
            geom = QgsGeometry.fromPolygon(polygon)
            QgsMessageLog.logMessage(str(geom.isGeosValid()))
            feature = QgsFeature()
            feature.setGeometry(geom)
            return feature


        featurelist=[]
        geometrytype= vectorlayer.geometryType()
        if geometrytype == QGis.Point:
            points = utils.to_qgspoints(vlist)
            features = createpoints(points)
            featurelist.extend(features)

        elif geometrytype == QGis.Line:
            pointlist = utils.to_qgspoints(vlist, repeatfirst=surveytype == 'radial')

            if as_segments:
                # If the line is to be draw as segments then we loop the pairs and create a line for each one.
                for pair in utils.pairs(pointlist, matchtail=surveytype == 'polygonal'):
                    feature = createline(pair)
                    featurelist.append(feature)
            else:
                feature = createline(pointlist)
                featurelist.append(feature)

        elif geometrytype == QGis.Polygon:
            polygon = utils.to_qgspoints(vlist)
            feature = createpolygon([polygon])
            featurelist.append(feature)

        #commit
        provider=vectorlayer.dataProvider()
        provider.addFeatures(featurelist)
        if not self.useactivelayer:
            QgsMapLayerRegistry.instance().addMapLayer(vectorlayer)

        self.iface.mapCanvas().refresh()
Exemplo n.º 28
0
 def test_pairs_returns_non_matching_tail_head(self):
     points = [1, 2, 3, 4]
     pairs = utils.pairs(points, matchtail=False)
     one = pairs.next()
     two = pairs.next()
     self.assertNotEqual(one[1], two[0])
Exemplo n.º 29
0
 def hamil(xs, J):
     return dot(xs, hs) + J * (sum([xi * xj for (xi, xj) in pairs(xs)]))
Exemplo n.º 30
0
                                 columns=columns,
                                 data=frames_data)
    for keyframe_idx in df_keys.index:
        df_frames.ix[keyframe_idx] = df_keys.ix[keyframe_idx]
    return df_frames

interpolated_basemanualcurve = interpolate_curve(basemanualcurve_keys)
interpolated_manualcurve = interpolate_curve(manualcurve_keys)
def element_anchors(curve_element, anchors):
    curve_element.clear()
    for x, y in anchors:
        anchor_element = etree.Element('AnchorXY')
        anchor_element.text = "{0} {1}".format(x, y)
        curve_element.append(anchor_element)


for frame_idx, filename in _frames.iteritems():
    with open(filename.replace('cr2', 'ufraw'), 'w') as file_:
        exposure = interpolated_exposure.ix[frame_idx]
        basemanualcurve_anchors = pairs(interpolated_basemanualcurve.ix[frame_idx])
        manualcurve_anchors = pairs(interpolated_manualcurve.ix[frame_idx])
        basemanualcurve_element = tree.find('BaseManualCurve')
        element_anchors(basemanualcurve_element, basemanualcurve_anchors)
        manualcurve_element = tree.find('ManualCurve')
        element_anchors(manualcurve_element, manualcurve_anchors)
        tree.find('Exposure').text = str(exposure)
        tree.find('InputFilename').text = os.path.abspath(filename)
        tree.find('OutputFilename').text = os.path.abspath(filename).replace('cr2', 'jpg')
        out_string = etree.tostring(tree, pretty_print=True)
        file_.write(out_string)
Exemplo n.º 31
0
def brownian_test(xs):
    """given a time series, test for gaussian increments by Shapiro-Wilks test.  """
    dxs = [x1-x0 for (x0,x1) in pairs(xs)]
    return scipy.stats.shapiro(dxs)
def random_integer_partition(N, A=4):
    cuts = [0] + sorted([random.randrange(N + 1) for i in range(A - 1)]) + [N]
    ns = [y - x for (x, y) in pairs(cuts)]
    if not sum(ns) == N:
        raise Exception(ns)
    return ns
Exemplo n.º 33
0
 def get_moralized(self):
     moral = self.dag.to_undirected()
     for node in self.parents.keys():
         for p1, p2 in pairs(self.parents[node]):
             moral.add_edge(p1, p2)
     return moral
Exemplo n.º 34
0
def frags_from_splits_ref(config,splits):
    all_endpoints = pairs(splits)
    bound_fragments = [(lep,rep) for (lep,rep) in all_endpoints if any(lep <= pos < rep for pos in config)]
    return bound_fragments
def make_frags(lamb):
    return pairs(breaks(lamb))
Exemplo n.º 36
0
 def highlight_hooping(self, cycles, reactions):
     for cycle, path in zip(cycles, reactions):
         for e, R in zip(pairs(cycle), path):
             mutable = self.edges[e][R]
             mutable.add_arrow(highlight=True)
Exemplo n.º 37
0
def fragments_from_breaks(breaks,G):
    endpoints = [0] + [i for (i,b) in enumerate(breaks) if b] + [G]
    return pairs(endpoints)
Exemplo n.º 38
0
def distances(bs):
    return map(uncurry(distance),pairs(bs))
 def ordered(ys):
     return all(y1 <= y2 for y1,y2 in pairs(ys))
Exemplo n.º 40
0
    motif = random_motif(L, n)
    pwm = sample_matrix(L, linear_sigma)
    pairwise_weights = [[[random.gauss(0, pairwise_sigma) for i in range(4)]
                         for j in range(4)] for k in range(L - 1)]
    return motif, copies, (pwm, pairwise_weights)


def btoi(b):
    return "ACGT".index(b)


def energy_score((pwm, pairwise_weights), seq):
    linear_score = score_seq(pwm, seq)
    pairwise_score = sum(weight[btoi(b1)][btoi(b2)]
                         for weight, (b1,
                                      b2) in zip(pairwise_weights, pairs(seq)))
    return linear_score + pairwise_score


def compute_Zb(G, (linear_weights, pairwise_weights)):
    pure_pairwise_weights = [[
        [pw[i][j] + lwi[i] + lwj[j] for j in range(4)] for i in range(4)
    ] for pw, (lwi, lwj) in zip(pairwise_weights, pairs(linear_weights))]
    Ws = [
        np.matrix([[exp(w[btoi(b1)][btoi(b2)]) for b2 in "ACGT"]
                   for b1 in "ACGT"]) for w in pure_pairwise_weights
    ]
    return np.array([1, 1, 1, 1]).dot(reduce(lambda x, y: x.dot(y),
                                             Ws)).dot(np.array([1, 1, 1,
                                                                1]))[0, 0]
Exemplo n.º 41
0
    def satisfy_constraints(self) -> None:
        for i in range(ParticleSystem.NUM_ITERATIONS):
            for ball in filter(lambda ball: ball.can_move, self.balls):
                # if the ball hits the ground, it is dead.
                if (ball.curr_pos[1] - Ball.radius) <= GROUND_Y:
                    print("Ball collided with the ground!")
                    ball.can_move = False
                    continue

                if ball.might_collide_with_wall():
                    p1 = np.asarray((WALL_X, GROUND_Y))
                    p2 = np.asarray((WALL_X, SCREEN_HEIGHT - 1))
                    collision, wall_p, penetration_distance = circle_line_intersection(
                        ball.curr_pos, Ball.radius, p1, p2)
                    if collision:
                        print("Ball Collided with the wall!")
                        print(collision, wall_p, penetration_distance)
                        velocity = ball.curr_pos - ball.prev_pos
                        restitution_coefficient: float = 0.95
                        # Only the x-component of the velocity is changed (since the wall is vertical)
                        velocity[0] *= -1 * restitution_coefficient
                        # get the ball out of the wall by sliding it to the right.
                        ball.curr_pos[0] += penetration_distance
                        # set the ball's velocity.
                        ball.prev_pos = ball.curr_pos - velocity
                        # can't possibly collide with anything else at the same time.
                        continue

                elif ball.might_collide_with_mountain():
                    # check if the ball collidies with a line of the mountain.
                    for p0, p1 in pairs(self.mountain_points):
                        result = circle_line_intersection(
                            ball.curr_pos, Ball.radius, p0, p1)
                        collision, mountain_p, penetration_dist = result
                        if not collision:
                            continue
                        print("Ball Collided with the mountain!")
                        print(mountain_p, penetration_dist)

                        restitution_coefficient: float = 0.50
                        # the mountain segment is the tangential vector to the collision.
                        tangential = p1 - p0
                        tangential /= np.linalg.norm(tangential)
                        # the normal is perpendicular to the mountain segment.
                        # TODO: we want the upward-pointing normal, does this matter ?
                        normal = np.asarray((-tangential[1], tangential[0]),
                                            float)

                        # move the ball out of the mountain.
                        ball.curr_pos += normal * penetration_dist

                        velocity = ball.curr_pos - ball.prev_pos

                        v_tangent = np.dot(velocity, tangential)
                        v_normal = np.dot(velocity, normal)

                        # inelastic collision: the normal component is reversed.
                        v_normal *= -1 * restitution_coefficient
                        new_velocity = v_tangent * tangential + v_normal * normal
                        # set the ball's velocity
                        ball.prev_pos = ball.curr_pos - new_velocity
                        break
                min_constraint = (0, GROUND_Y)
                max_constraint = (SCREEN_WIDTH, SCREEN_HEIGHT)
                ball.curr_pos = np.max([ball.curr_pos, min_constraint], axis=0)
                ball.curr_pos = np.min([ball.curr_pos, max_constraint], axis=0)

            for turkey in self.turkeys:
                min_constraint = (0.0, GROUND_Y)
                max_constraint = (MOUNTAIN_START_X, SCREEN_HEIGHT)
                for particle in turkey.particles:
                    particle.curr_pos = np.max(
                        [particle.curr_pos, min_constraint], axis=0)
                    particle.curr_pos = np.min(
                        [particle.curr_pos, max_constraint], axis=0)

                for constraint in turkey.stick_constraints:
                    constraint.apply()
Exemplo n.º 42
0
 def test_pairs_returns_non_matching_tail_head(self):
     points = [1,2,3,4]
     pairs = utils.pairs(points, matchtail=False)
     one = pairs.next()
     two = pairs.next()
     self.assertNotEqual(one[1], two[0])
Exemplo n.º 43
0
    def addgeometry(self):
        #initialization
        s = QSettings()
        if self.useactivelayer:
            vectorlayer = self.iface.activeLayer()
        else:
            oldValidation = s.value("/Projections/defaultBehaviour",
                                    "useProject")
            s.setValue("/Projections/defaultBehaviour", "useProject")
            vectorlayer = QgsVectorLayer("LineString", "tmp_plot", "memory")
            s.setValue("/Projections/defaultBehaviour", oldValidation)

        # if magnetic heading chosen, assure we have a declination angle
        if (self.pluginGui.radioButton_magNorth.isChecked()) and (
                str(self.pluginGui.lineEdit_magNorth.text())
                == ''):  #magnetic headings
            self.say("No magnetic declination value entered.")
            return 0

        #Get starting point coordinates
        X0 = float(str(self.pluginGui.lineEdit_vertexX0.text()))
        Y0 = float(str(self.pluginGui.lineEdit_vertexY0.text()))
        Z0 = float(str(self.pluginGui.lineEdit_vertexZ0.text()))

        #check if the starting point is specified
        if (X0 == 0 and Y0 == 0 and Z0 == 90):
            self.say("You must supply a starting point.")
            return 0

        # Check if there are any segments
        if (self.pluginGui.table_segmentList.rowCount() < 1):
            self.say("You must enter at least one segment.")
            return 0

        if (self.pluginGui.radioButton_radialSurvey.isChecked()):
            surveytype = 'radial'
        elif (self.pluginGui.radioButton_boundarySurvey.isChecked()):
            surveytype = 'polygonal'

        arcpoint_count = self.pluginGui.spin_arclines.value()

        def get_points(surveytype):
            """
            Return a list of calculated points for the full run.
            :param surveytype:
            :return:
            """
            vlist = []
            vlist.append(utils.Point(X0, Y0, Z0))
            # convert segment list to set of vertice
            for i in range(self.pluginGui.table_segmentList.rowCount()):
                az = str(self.pluginGui.table_segmentList.item(i, 0).text())
                dis = float(
                    str(self.pluginGui.table_segmentList.item(i, 1).text()))
                zen = str(self.pluginGui.table_segmentList.item(i, 2).text())
                direction = str(
                    self.pluginGui.table_segmentList.item(i, 4).text())
                direction = utils.Direction.resolve(direction)

                try:
                    radius = float(
                        self.pluginGui.table_segmentList.item(i, 3).text())
                except ValueError:
                    radius = None

                if (self.pluginGui.radioButton_englishUnits.isChecked()):
                    # adjust for input in feet, not meters
                    dis = float(dis) / 3.281

                #checking degree input
                if (self.pluginGui.radioButton_azimuthAngle.isChecked()):
                    az = float(self.dmsToDd(az))
                    zen = float(self.dmsToDd(zen))
                elif (self.pluginGui.radioButton_bearingAngle.isChecked()):
                    az = float(self.bearingToDd(az))
                    zen = float(self.bearingToDd(zen))

                #correct for magnetic compass headings if necessary
                if (self.pluginGui.radioButton_defaultNorth.isChecked()):
                    self.magDev = 0.0
                elif (self.pluginGui.radioButton_magNorth.isChecked()):
                    self.magDev = float(
                        self.dmsToDd(
                            str(self.pluginGui.lineEdit_magNorth.text())))
                az = float(az) + float(self.magDev)

                #correct for angles outside of 0.0-360.0
                while (az > 360.0):
                    az = az - 360.0
                while (az < 0.0):
                    az = az + 360.0

                # checking survey type
                if surveytype == 'radial':
                    reference_point = vlist[0]  # reference first vertex

                if surveytype == 'polygonal':
                    reference_point = vlist[-1]  #reference previous vertex

                nextpoint = utils.nextvertex(reference_point, dis, az, zen)
                log(nextpoint)
                log(reference_point)

                if radius:
                    # If there is a radius then we are drawing a arc.
                    # Calculate the arc points.
                    points = list(
                        utils.arc_points(reference_point,
                                         nextpoint,
                                         dis,
                                         radius,
                                         point_count=arcpoint_count,
                                         direction=direction))

                    if direction == utils.Direction.ANTICLOCKWISE:
                        points = reversed(points)

                    # Append them to the final points list.
                    vlist.extend(points)

                vlist.append(nextpoint)

            return vlist

        #reprojecting to projects SRS
        points = get_points(surveytype)
        vlist = self.reproject(points, vectorlayer)

        as_segments = self.pluginGui.checkBox_asSegments.isChecked()

        def createpoints(points):
            for point in points:
                geom = QgsGeometry.fromPoint(point)
                feature = QgsFeature()
                feature.setGeometry(geom)
                yield feature

        def createline(points):
            """
            Creata a line feature from a list of points
            :param points: List of QgsPoints
            """
            geom = QgsGeometry.fromPolyline(points)
            feature = QgsFeature()
            feature.setGeometry(geom)
            return feature

        def createpolygon(polygon):
            """
            Create a polygon from a list of points
            :param points: List of QgsPoints
            """
            geom = QgsGeometry.fromPolygon(polygon)
            QgsMessageLog.logMessage(str(geom.isGeosValid()))
            feature = QgsFeature()
            feature.setGeometry(geom)
            return feature

        featurelist = []
        geometrytype = vectorlayer.geometryType()
        if geometrytype == QGis.Point:
            points = utils.to_qgspoints(vlist)
            features = createpoints(points)
            featurelist.extend(features)

        elif geometrytype == QGis.Line:
            pointlist = utils.to_qgspoints(vlist,
                                           repeatfirst=surveytype == 'radial')

            if as_segments:
                # If the line is to be draw as segments then we loop the pairs and create a line for each one.
                for pair in utils.pairs(pointlist,
                                        matchtail=surveytype == 'polygonal'):
                    feature = createline(pair)
                    featurelist.append(feature)
            else:
                feature = createline(pointlist)
                featurelist.append(feature)

        elif geometrytype == QGis.Polygon:
            polygon = utils.to_qgspoints(vlist)
            feature = createpolygon([polygon])
            featurelist.append(feature)

        #commit
        provider = vectorlayer.dataProvider()
        provider.addFeatures(featurelist)
        if not self.useactivelayer:
            QgsMapLayerRegistry.instance().addMapLayer(vectorlayer)

        self.iface.mapCanvas().refresh()
Exemplo n.º 44
0
def main(args):
    import model_utils as mutils
    # Set the parameters from the specified file BEFORE any model.* import
    import model
    mutils.set_model_ps(args.psfile)

    import numpy as np
    import analysis
    import plotting
    from utils import print_dict, pairs
    from scipy.signal import resample

    from model.glomerule import Glomerule
    from model.mitral_cells import MitralCells
    from model.synapse import Synapse
    from model.granule_cells import GranuleCells

    # Reset old stuff from Brian memory
    clear(erase=True, all=True)
    defaultclock.reinit()

    # Initialize random generator (necessary mainly for parallel simulations)
    np.random.seed()
    
    """
    Parameters
    ----------
    Get the parameter values from the `ps` module, which in turn gets the values
    from the file specified in parameters.py.

    Set some aliases for the different cell population sizes.
    Also check that there is an even number of cells for each column.

    Finally set some simulation parameters.

    """
    psmt     = model.PARAMETERS['Mitral']
    psgr     = model.PARAMETERS['Granule']
    pscommon = model.PARAMETERS['Common']

    n_mitral    = pscommon['N_mitral']
    n_glomeruli = n_granule = n_subpop = pscommon['N_subpop']

    # check to have an even number of mitral in each sub-population
    assert n_mitral % n_subpop == 0, \
           "N_mitral is not a multiple of the number of sub-populations N_subpop."
    n_mitral_per_subpop = n_mitral/n_subpop

    defaultclock.dt = pscommon['simu_dt']
    simu_length     = pscommon['simu_length']


    """
    Population Initialization
    -------------------------
    1. glomeruli
    *. synapses between granule and mitral cells
    3. mitral cells
    4. granule cells

    """
    # Glomeruli
    glom = Glomerule()
    glom.add_eqs()
    glom.make_pop(n_glomeruli*n_mitral_per_subpop)

    # Synapses (granule -- mitral)
    synexc = Synapse(synapse_type='exc') # excitatory synapse
    synexc.set_eqs_model()

    syninhib = Synapse(synapse_type='inhib') # inhibitory synapse
    syninhib.set_eqs_model()

    # Mitral cells
    mt = MitralCells()
    mt_supp_eqs =  {'var': ['- I_syn', '- g_input*V'],
                    'eqs': [synexc.get_eqs_model(),
                            Equations("g_input : siemens*meter**-2")]}
    mt.add_eqs(supp_eqs=mt_supp_eqs)
    mt.make_pop(n_mitral)
    mt.pop.V = (psmt['V_t'] - psmt['V_r'])*np.random.random_sample(np.shape(mt.pop.V)) \
               + psmt['V_r']

    # Granule Cells
    gr = GranuleCells()
    gr_supp_eqs = {'var': ['-I_syn'],
                   'eqs': [syninhib.get_eqs_model()]}
    gr.add_eqs(supp_eqs=gr_supp_eqs)
    gr.make_pop(n_granule)
    gr.pop.V_D = psgr['E_L']
    gr.pop.V_S = psgr['E_L']


    """
    Connecting Populations
    ----------------------
    1. Glomeruli and mitral cells 
    2. Mitral cells and granule cells

    """
    # Connecting mitral cells to glomeruli
    glmt_connections = diag(ones(n_mitral))

    # Glomeruli--Mitral interactions
    @network_operation(when='start')
    def mt_input():
        mt.pop.g_input = dot(glom.pop.g, glmt_connections)

    # Connecting sub-population of mitral cells to granule cells
    mtgr_connections = mutils.intrapop_connections(n_mitral, n_granule, n_subpop, n_mitral_per_subpop)

    # Inter subpopulation connectivities
    inter_conn_rate = pscommon['inter_conn_rate']
    inter_conn_strength = pscommon['inter_conn_strength']
    homeostasy = pscommon['homeostasy']
    mtgr_connections, grmt_connections = mutils.interpop_connections(mtgr_connections, n_mitral, n_subpop,
                                            n_mitral_per_subpop, inter_conn_rate, inter_conn_strength,homeostasy)
    # Mitral--Granule interactions
    @network_operation(when='start')
    def graded_synapse():
        """Computes granule and mitral s_syn"""
        mt.pop.state('T')[:] = 0.
        mt.pop.state('T')[mt.pop.get_refractory_indices()] = 1.
        gr.pop.s_syn = dot(mt.pop.s, mtgr_connections)
        mt.pop.s_syn = dot(gr.pop.s, grmt_connections)

    @network_operation(when='start')
    def sum_s():
        """Computes granule self s_syn (for its glomerular column only)"""
        for subpop in xrange(n_subpop):
            start = subpop*n_mitral_per_subpop
            stop  = start + n_mitral_per_subpop
            gr.pop.s_syn_self[subpop] = sum(mt.pop.state('s')[start:stop])

    @network_operation(when='after_groups')
    def keep_reset():
        mt.pop.state('V')[mt.pop.get_refractory_indices()] = psmt['V_r']


    """
    Simulation Monitoring
    ---------------------
    Monitor state variables for the different populations.

    """
    glom_ps = ('g')
    mt_ps   = ('s', 's_syn', 'V')
    gr_ps   = ('V_D', 's_syn', 's', 's_syn_self')

    # Simulation monitors
    rec_neurons = True  # Must be set to True if we want accurate MPS and STS
    timestep = int(pscommon['resample_dt']/pscommon['simu_dt'])
    monit_glom = mutils.monit(glom.pop, glom_ps, timestep, reclist=rec_neurons)
    monit_mt   = mutils.monit(mt.pop, mt_ps, timestep, reclist=rec_neurons, spikes=True)
    monit_gr   = mutils.monit(gr.pop, gr_ps, timestep)


    """
    Running Simulation
    ------------------
    Create Network object and put everything simulation related in it.
    Then run this network.

    """
    # Gathering simulation objects
    netw = Network(glom.pop, mt.pop, gr.pop,
                   mt_input, graded_synapse, keep_reset, sum_s,
                   [m for m in monit_glom.values()],
                   [m for m in monit_mt.values()],
                   [m for m in monit_gr.values()])

    # Simulation run
    if args.no_brian_output:
        report_output = None
    else:
        report_output = "text"
    netw.run(simu_length, report=report_output)


    """
    Information Output
    ------------------

    """
    if args.full_ps:
        print 'Full set of parameters:'
        print_dict(model.PARAMETERS)

    burnin = pscommon['burnin']
    times = monit_gr['s'].times
    sig_start = where(times > burnin)[0][0]

    sts_indexes = {}
    mps_indexes = {}
    fftmax = {}
    mps_indexes['whole'] = analysis.mps(monit_mt['V'], 0, n_mitral, sig_start)
    gr_s_syn_self_whole = np.zeros(monit_gr['s_syn_self'][0].shape)

    # MPS and STS computation for subpopulation
    for subpop in xrange(n_subpop):
        start = subpop*n_mitral_per_subpop
        stop = start + n_mitral_per_subpop
        sts = analysis.sts(monit_gr['s_syn_self'][subpop], monit_mt['spikes'], start, stop, sig_start, burnin)
        sts_indexes[subpop] = sts
        gr_s_syn_self_whole += monit_gr['s_syn_self'][subpop]
        mps = analysis.mps(monit_mt['V'], start, stop, sig_start)
        mps_indexes[subpop] = mps

    # STS for the whole population
    sts_indexes['whole'] = analysis.sts(gr_s_syn_self_whole, monit_mt['spikes'], 0, n_mitral, sig_start, burnin)

    # FFT Max index
    fftmax = analysis.fftmax(monit_gr['s_syn_self'], n_subpop, pscommon['resample_dt'], sig_start)

    # Peak distances index
    peak_distances = {}
    if n_subpop > 1:
        for sub_i, sub_j in pairs(n_subpop):
            sig1 = monit_gr['s_syn_self'][sub_i]
            sig2 = monit_gr['s_syn_self'][sub_j]
            if not peak_distances.has_key(sub_i):
                peak_distances[sub_i] = {}
            pd_index = analysis.peak_dist_circ_index(sig1, sig2)
            peak_distances[sub_i][sub_j] = {}
            peak_distances[sub_i][sub_j]['mean'] = pd_index[0]
            peak_distances[sub_i][sub_j]['disp'] = pd_index[1]

    if not args.no_summary:
        print '\nParameters: using', args.psfile

        print 'Populations:', n_subpop, 'glomerular columns;',
        print n_mitral, 'mitral cells;', n_granule, 'granule cells.'

        print 'Times:', simu_length, 'of simulation; dt =', defaultclock.dt, '.'

        print 'Indexes: STS =', sts_indexes, '\nMPS =', mps_indexes
        print 'FFT peaks (Hz):', fftmax
        print 'Peak distances index:', peak_distances

    """
    Plotting
    --------
    Plot monitored variables and a scatter plot.

    """
    if not args.no_plot:
        # Raster plot
        spikes_it = monit_mt['spikes'].it
        plotting.raster_plot(spikes_it[0], spikes_it[1], mtgr_connections)
        # Membrane potentials
        if not rec_neurons:  # if we only have a couple of recorded neurons
            plotting.memb_plot_figure(monit_mt, monit_gr, rec_neurons, n_granule)
        # Granule synapses
        plotting.granule_figure(monit_gr, pscommon)
        show()


    """
    Simulation records
    ------------------

    Put numpy arrays in var `results` to save them into the simulation record.
    Note: the variable must be monitored by Brian.

    """
    # Add parameters
    ps_arrays = {'mtgr_connections': (mtgr_connections,
                            "Connection matrix from mitral (rows) to granules (columns)")}

    # Add results
    array_spikes_it = np.array((monit_mt['spikes'].it[0],
                                monit_mt['spikes'].it[1]))
    results = {}

    # Mean inputs
    mean_inputs = np.ndarray((n_glomeruli, monit_glom['g'].values.shape[1]))
    for glom in xrange(n_glomeruli):
        start_subpop = glom*n_mitral_per_subpop
        stop_subpop = start_subpop + n_mitral_per_subpop
        mean_inputs[glom] = np.mean(monit_glom['g'].values[start_subpop:stop_subpop], axis=0)

    # Mean membrane potentials
    mean_memb_pot = np.ndarray((n_glomeruli*2, monit_mt['V'].values.shape[1]))
    bin_interco_matrix = (mtgr_connections > 0.)
    interco_neurons = (bin_interco_matrix.sum(axis=1) > 1)
    for glom in xrange(n_glomeruli):
        start_subpop = glom*n_mitral_per_subpop
        stop_subpop = start_subpop + n_mitral_per_subpop
        # Get subpopulation membrane potentials and interconnected neurons
        subpop_memb_pot = monit_mt['V'].values[start_subpop:stop_subpop]
        subpop_interco_neurons = interco_neurons[start_subpop:stop_subpop]
        # Compute one mean for interconnected neurons and another for the other neurons
        mean_pop = np.mean(subpop_memb_pot[~subpop_interco_neurons], axis=0)
        mean_pop_interco = np.mean(subpop_memb_pot[subpop_interco_neurons], axis=0)
        mean_memb_pot[glom*2] = mean_pop
        mean_memb_pot[glom*2 + 1] = mean_pop_interco

    results['data'] = {'spikes_it': [array_spikes_it,
                           "Spikes: one array for the neuron number, another one for the spike times."],
                       'input': [mean_inputs,
                           "Mean network input conductance value for each glomerule."],
                       's_granule': [monit_gr['s'].values,
                           "Variable 's' of the granules."],
                       's_syn_self': [monit_gr['s_syn_self'].values,
                           "Variable 's_syn' for the granule, without  integrating the mitral 's' from other subpopulations."],
                       'mean_memb_pot': [mean_memb_pot,
                            "Mean membrane potential. For each subpop: one mean for the interconnected neurons and one mean for the non-interconnected neurons."]}

    results['indexes'] = {'MPS': mps_indexes, 'STS': sts_indexes, 'FFTMAX': fftmax,
                          'peak_distances': peak_distances}

    return {'set': model.PARAMETERS, 'arrays': ps_arrays}, results
Exemplo n.º 45
0
def score_site(code, bd, site):
    return sum(code[aa, n1, n2] for aa, (n1, n2) in zip(bd, pairs(site)))