def findORFs(kozakfp):
for read in reads:
try:
for translation in translations(read):
for orf in translation.ORFs(allowOpenORFs):
# Check the length requirements, if any.
if ((minORFLength is None or len(orf) >= minORFLength)
and (maxORFLength is None
or len(orf) <= maxORFLength)):
if kozakOnly:
for kozakread in findKozakConsensus(read):
start = orf.start * 3
if (start + 1 <= kozakread.stop <=
start + 3):
print(orf.toString('fasta'), end='')
else:
print(orf.toString('fasta'), end='')
if kozakfp:
for kozakread in findKozakConsensus(read):
start = orf.start * 3
if (start + 1 <= kozakread.stop <=
start + 3):
writeToKozakOut(kozakread, kozakfp)
except TranslationError as error:
print('Could not translate read %r sequence %r (%s).' %
(read.id, read.sequence, error),
file=sys.stderr)
if not aa:
print('Did you forget to run '
'%s with "--readClass AARead"?' %
(basename(sys.argv[0])),
file=sys.stderr)
sys.exit(1)
def testKozakConsensusAtEndPart(self):
"""
In a given sequence without a Kozak consensus, the output should be
as expected.
"""
read = DNARead('id', 'AAAAAAATTGCCGCCATG')
self.assertEqual([], list(findKozakConsensus(read)))
def testKozakConsensusAtEndPart(self):
"""
In a given sequence without a Kozak consensus, the output should be
as expected.
"""
read = DNARead('id', 'AAAAAAATTGCCGCCATG')
self.assertEqual([], list(findKozakConsensus(read)))
def testKozakConsensusAtEnd(self):
"""
In a given sequence without a Kozak consensus, the output should be
as expected.
"""
read = DNARead('id', 'AAAAAAATTGCCGCCATGG')
expectedKozakRead = DNAKozakRead(read, 9, 19, 100.0)
(result, ) = list(findKozakConsensus(read))
self.assertEqual(expectedKozakRead, result)
def testOneKozakConsensus(self):
"""
In a given sequence with an exact Kozak consensus sequence, the offset
and quality percentage should be as expected.
"""
read = DNARead('id', 'ATTGCCGCCATGGGGG')
expectedKozakRead = DNAKozakRead(read, 3, 13, 100.0)
(result, ) = list(findKozakConsensus(read))
self.assertEqual(expectedKozakRead, result)
def testKozakConsensusAtEnd(self):
"""
In a given sequence without a Kozak consensus, the output should be
as expected.
"""
read = DNARead('id', 'AAAAAAATTGCCGCCATGG')
expectedKozakRead = DNAKozakRead(read, 9, 19, 100.0)
(result,) = list(findKozakConsensus(read))
self.assertEqual(expectedKozakRead, result)
def testOneKozakConsensus(self):
"""
In a given sequence with an exact Kozak consensus sequence, the offset
and quality percentage should be as expected.
"""
read = DNARead('id', 'ATTGCCGCCATGGGGG')
expectedKozakRead = DNAKozakRead(read, 3, 13, 100.0)
(result,) = list(findKozakConsensus(read))
self.assertEqual(expectedKozakRead, result)
def testFindTwoKozakConsensi(self):
"""
In a given sequence with two Kozak consensuses with different offsets
and qualities, the output should be as expected.
"""
read = DNARead('id', 'ATTGCCGCCATGGGGGGCCATGG')
expectedRead1 = DNARead('id', 'ATTGCCGCCATGGGGGGCCATGG')
expectedRead2 = DNARead('id', 'ATTGCCGCCATGGGGGGCCATGG')
expectedKozakRead1 = DNAKozakRead(expectedRead1, 3, 13, 100.0)
expectedKozakRead2 = DNAKozakRead(expectedRead2, 13, 23, 60.0)
self.assertEqual([expectedKozakRead1, expectedKozakRead2],
list(findKozakConsensus(read)))
def testFindTwoKozakConsensi(self):
"""
In a given sequence with two Kozak consensuses with different offsets
and qualities, the output should be as expected.
"""
read = DNARead('id', 'ATTGCCGCCATGGGGGGCCATGG')
expectedRead1 = DNARead('id', 'ATTGCCGCCATGGGGGGCCATGG')
expectedRead2 = DNARead('id', 'ATTGCCGCCATGGGGGGCCATGG')
expectedKozakRead1 = DNAKozakRead(expectedRead1, 3, 13, 100.0)
expectedKozakRead2 = DNAKozakRead(expectedRead2, 13, 23, 60.0)
self.assertEqual([expectedKozakRead1, expectedKozakRead2],
list(findKozakConsensus(read)))
def testShortSequence(self):
"""
If a 4 nt long sequence is given, no Kozak sequence should be found.
"""
read = DNARead('id', 'ATTG')
self.assertEqual([], list(findKozakConsensus(read)))
def testNoSequence(self):
"""
If no sequence is given, no Kozak sequence should be found.
"""
read = DNARead('id', '')
self.assertEqual([], list(findKozakConsensus(read)))
def testShortSequence(self):
"""
If a 4 nt long sequence is given, no Kozak sequence should be found.
"""
read = DNARead('id', 'ATTG')
self.assertEqual([], list(findKozakConsensus(read)))
def testNoSequence(self):
"""
If no sequence is given, no Kozak sequence should be found.
"""
read = DNARead('id', '')
self.assertEqual([], list(findKozakConsensus(read)))
