def test_ne_true(self):
s1 = Sequence(self.label, self.sequence)
s2 = Sequence(self.label, "---aggatgcgagatgcgtgtt-----")
self.assertTrue(s1 != s2)
self.assertTrue(s1 != 2)
self.assertTrue(s1 != "---aggatgcgagatgcgtgtt-----")
def test_eq_true(self):
s1 = Sequence(self.label, self.sequence)
s2 = Sequence(self.label, self.sequence)
self.assertTrue(s1 == s2)
s2 = Sequence("152_4447;size=1812;", self.sequence)
self.assertTrue(s1 == s2)
def test_eq_false(self):
s1 = Sequence(self.label, self.sequence)
s2 = Sequence(self.label, "---aggatgcgagatgcgtgtt-----")
self.assertFalse(s1 == s2)
self.assertFalse(s1 == 2)
self.assertFalse(s1 == "---aggatgcgagatgcgtgtt-----")
def test_ne_false(self):
s1 = Sequence(self.label, self.sequence)
s2 = Sequence(self.label, self.sequence)
self.assertFalse(s1 != s2)
s2 = Sequence("152_4447;size=1812;", self.sequence)
self.assertFalse(s1 != s2)
def test_deblur_with_non_default_error_profile(self):
error_dist = [
1, 0.05, 0.000005, 0.000005, 0.000005, 0.000005, 0.0000025,
0.0000025, 0.0000025, 0.0000025, 0.0000025, 0.0000005, 0.0000005,
0.0000005, 0.0000005
]
seqs_f = StringIO(TEST_SEQS_2)
obs = deblur(sequence_generator(seqs_f), error_dist=error_dist)
exp = [
Sequence(
"E.Coli-999;size=720;",
"tacggagggtgcaagcgttaatcggaattactgggcgtaaagcgcacgcaggcggt"
"ttgttaagtcagatgtgaaatccccgggctcaacctgggaactgcatctgatactg"
"gcaagcttgagtctcgtagaggggggcagaattccag")
]
self.assertEqual(obs, exp)
error_dist = np.array([
1, 0.06, 0.02, 0.02, 0.01, 0.005, 0.005, 0.005, 0.001, 0.001,
0.001, 0.0005
])
seqs_f = StringIO(TEST_SEQS_2)
obs = deblur(sequence_generator(seqs_f), error_dist=error_dist)
exp = [
Sequence(
"E.Coli-999;size=720;",
"tacggagggtgcaagcgttaatcggaattactgggcgtaaagcgcacgcaggcggt"
"ttgttaagtcagatgtgaaatccccgggctcaacctgggaactgcatctgatactg"
"gcaagcttgagtctcgtagaggggggcagaattccag")
]
self.assertEqual(obs, exp)
def test_get_sequences(self):
exp_seqs = [
Sequence("151_4447;size=1812;", "---aggatgcgagatgcgtggt-----"),
Sequence("151_3288;size=1337;", "---ggatgcgagatgcgtggtg-----"),
Sequence("151_6640;size=1068;", "---cggaggcgagatgcgtggt-----"),
Sequence("151_5155;size=998;", "---gaggatgcgagatgcgtgg-----"),
Sequence("151_527;size=964;", "---acggaggatgatgcgcggt-----"),
Sequence("151_14716;size=390;", "---gagtgcgagatgcgtggtg-----"),
Sequence("151_5777;size=305;", "---ggagtgcaagattccaggt-----"),
Sequence("151_64278;size=200;", "---tactagcaagattcctggt-----"),
Sequence("151_9240;size=170;", "---tagggcaagactccatggt-----"),
Sequence("151_41690;size=157;", "---agg-gcgagattcctagtgg----")]
obs_seqs = get_sequences(self.seqs)
self.assertEqual(obs_seqs, exp_seqs)
def test_deblur_indel(self):
"""Test if also removes indel sequences
"""
seqs_f = StringIO(TEST_SEQS_2)
# add the MSA for the indel
seqs = sequence_generator(seqs_f)
newseqs = []
for chead, cseq in seqs:
tseq = cseq[:10] + '-' + cseq[10:]
newseqs.append((chead, tseq))
# now add a sequence with an A insertion
tseq = cseq[:10] + 'A' + cseq[10:-1] + '-'
newseqs.append((chead, tseq))
obs = deblur(newseqs)
# remove the '-' (same as in launch_workflow)
for s in obs:
s.sequence = s.sequence.replace('-', '')
# the expected output
exp = [
Sequence(
"E.Coli-999;size=720;",
"tacggagggtgcaagcgttaatcggaattactgggcgtaaagcgcacgcaggcggt"
"ttgttaagtcagatgtgaaatccccgggctcaacctgggaactgcatctgatactg"
"gcaagcttgagtctcgtagaggggggcagaattccag")
]
# make sure we get 1 sequence as output
self.assertEqual(len(obs), 1)
# and that it is the correct sequence
self.assertEqual(obs[0].sequence, exp[0].sequence)
def test_init(self):
obs = Sequence(self.label, self.sequence)
self.assertEqual(obs.label, self.label)
self.assertEqual(obs.sequence, self.exp_seq)
self.assertEqual(obs.length, 27)
self.assertEqual(obs.unaligned_length, 19)
self.assertEqual(obs.frequency, 1812)
npt.assert_equal(obs.np_sequence, self.exp_np_seq)
def test_init_mixed_case(self):
sequence = "---AggATgcGAgatGCgtgGT-----"
obs = Sequence(self.label, sequence)
self.assertEqual(obs.label, self.label)
self.assertEqual(obs.sequence, self.exp_seq)
self.assertEqual(obs.length, 27)
self.assertEqual(obs.unaligned_length, 19)
self.assertEqual(obs.frequency, 1812)
npt.assert_equal(obs.np_sequence, self.exp_np_seq)
def test_init_uppercase(self):
sequence = "---AGGATGCGAGATGCGTGGT-----"
obs = Sequence(self.label, sequence)
self.assertEqual(obs.label, self.label)
self.assertEqual(obs.sequence, self.exp_seq)
self.assertEqual(obs.length, 27)
self.assertEqual(obs.unaligned_length, 19)
self.assertEqual(obs.frequency, 1812)
npt.assert_equal(obs.np_sequence, self.exp_np_seq)
def test_deblur(self):
seqs_f = StringIO(TEST_SEQS_2)
obs = deblur(parse_fasta(seqs_f))
exp = [
Sequence("E.Coli-999;size=720;",
"tacggagggtgcaagcgttaatcggaattactgggcgtaaagcgcacgcaggcggt"
"ttgttaagtcagatgtgaaatccccgggctcaacctgggaactgcatctgatactg"
"gcaagcttgagtctcgtagaggggggcagaattccag")]
self.assertEqual(obs, exp)
def test_deblur_toy_example(self):
seqs_f = StringIO(TEST_SEQS_1)
obs = deblur(sequence_generator(seqs_f))
exp = [
Sequence(
"E.Coli;size=1000;",
"tacggagggtgcaagcgttaatcggaattactgggcgtaaagcgcacgcaggcggt"
"ttgttaagtcagatgtgaaatccccgggctcaacctgggaactgcatctgatactg"
"gcaagcttgagtctcgtagaggggggcagaattccag")
]
self.assertEqual(obs, exp)
def test_to_fasta(self):
seq = Sequence(self.label, self.sequence)
obs = seq.to_fasta()
exp = ">151_4447;size=1812;\n---AGGATGCGAGATGCGTGGT-----\n"
self.assertEqual(obs, exp)
seq.frequency = 1811.1
obs = seq.to_fasta()
exp = ">151_4447;size=1811;\n---AGGATGCGAGATGCGTGGT-----\n"
self.assertEqual(obs, exp)
seq.frequency = 1811.5
obs = seq.to_fasta()
exp = ">151_4447;size=1812;\n---AGGATGCGAGATGCGTGGT-----\n"
self.assertEqual(obs, exp)
def test_init_non_actg_chars(self):
sequence = "---FoOatgcgagatgcgtfOo-----"
exp_seq = "---FOOATGCGAGATGCGTFOO-----"
exp_np_seq = np.array([
4, 4, 4, 5, 5, 5, 0, 3, 2, 1, 2, 0, 2, 0, 3, 2, 1, 2, 3, 5, 5, 5,
4, 4, 4, 4, 4
])
obs = Sequence(self.label, sequence)
self.assertEqual(obs.label, self.label)
self.assertEqual(obs.sequence, exp_seq)
self.assertEqual(obs.length, 27)
self.assertEqual(obs.unaligned_length, 19)
self.assertEqual(obs.frequency, 1812)
npt.assert_equal(obs.np_sequence, exp_np_seq)
def test_deblur_indel(self):
"""Test if also removes indel sequences
"""
seqs_f = StringIO(TEST_SEQS_2)
# add the MSA for the indel
seqs = sequence_generator(seqs_f)
newseqs = []
for chead, cseq in seqs:
tseq = cseq[:10] + '-' + cseq[10:]
newseqs.append((chead, tseq))
# now add a sequence with an A insertion at the expected freq. (30 < 0.02 * (720 / 0.47) where 0.47 is the mod_factor) so should be removed
cseq = newseqs[0][1]
tseq = cseq[:10] + 'A' + cseq[11:-1] + '-'
chead = '>indel1-read;size=30;'
newseqs.append((chead, tseq))
# and add a sequence with an A insertion but at higher freq. (not expected by indel upper bound - (31 > 0.02 * (720 / 0.47) so should not be removed)
cseq = newseqs[0][1]
tseq = cseq[:10] + 'A' + cseq[11:-1] + '-'
chead = '>indel2-read;size=31;'
newseqs.append((chead, tseq))
obs = deblur(newseqs)
# remove the '-' (same as in launch_workflow)
for s in obs:
s.sequence = s.sequence.replace('-', '')
# the expected output
exp = [
Sequence(
"E.Coli-999;size=720;",
"tacggagggtgcaagcgttaatcggaattactgggcgtaaagcgcacgcaggcggt"
"ttgttaagtcagatgtgaaatccccgggctcaacctgggaactgcatctgatactg"
"gcaagcttgagtctcgtagaggggggcagaattccag")
]
# make sure we get 2 sequences as output - the original and the indel2 (too many reads for the expected indel probabilty)
self.assertEqual(len(obs), 2)
# and that it is the correct sequence
self.assertEqual(obs[0].sequence, exp[0].sequence)
self.assertEqual(obs[1].label, '>indel2-read;size=31;')
def get_sequences(input_seqs):
"""Returns a list of Sequences
Parameters
----------
input_seqs : iterable of (str, str)
The list of input sequences in (label, sequence) format
Returns
-------
list of Sequence
Raises
------
ValueError
If no sequences where found in `input_seqs`
If all the sequences do not have the same length either aligned or
unaligned.
"""
try:
seqs = [Sequence(id, seq) for id, seq in input_seqs]
except Exception:
seqs = []
if len(seqs) == 0:
logger = logging.getLogger(__name__)
logger.warn('No sequences found in fasta file!')
return None
# Check that all the sequence lengths (aligned and unaligned are the same)
aligned_lengths = set(s.length for s in seqs)
unaligned_lengths = set(s.unaligned_length for s in seqs)
if len(aligned_lengths) != 1 or len(unaligned_lengths) != 1:
raise ValueError(
"Not all sequence have the same length. Aligned lengths: %s, "
"sequence lengths: %s"
% (", ".join(map(str, aligned_lengths)),
", ".join(map(str, unaligned_lengths))))
seqs = sorted(seqs, key=attrgetter('frequency'), reverse=True)
return seqs