def preview():
dbConn = DatabaseConn()
db = dbConn.databaseConnect()
cursor = db.cursor()
hostname = dbConn.getHostname()
rHandler = ReagentHandler(db, cursor)
propMapper = ReagentPropertyMapper(db, cursor)
prop_Alias_ID_Map = propMapper.mapPropAliasID()
form = cgi.FieldStorage(keep_blank_values="True")
#print "Content-type:text/html" # REMOVE AFTER DEBUGGING TO HAVE SCRIPT REDIRECT PROPERLY!!!!!!
#print # DITTO
#print `form`
propVal = ""
if form.has_key("PV"):
pvVal = form.getvalue("PV")
pvID = rHandler.convertReagentToDatabaseID(pvVal)
if form.has_key("propAlias"):
propAlias = form.getvalue("propAlias")
if prop_Alias_ID_Map.has_key(propAlias):
propID = prop_Alias_ID_Map[propAlias]
propVal = rHandler.findSimplePropertyValue(pvID, propID)
print "Content-type:text/html" # REMOVE AFTER DEBUGGING TO HAVE SCRIPT REDIRECT PROPERLY!!!!!!
print # DITTO
print propVal
dbConn = DatabaseConn() db = dbConn.databaseConnect() cursor = db.cursor() hostname = dbConn.getHostname() root_path = dbConn.getRootDir() dnaHandler = DNAHandler(db, cursor) protHandler = ProteinHandler(db, cursor) rHandler = ReagentHandler(db, cursor) oHandler = OligoHandler(db, cursor) propHandler = ReagentPropertyHandler(db, cursor) packetHandler = ProjectDatabaseHandler(db, cursor) propMapper = ReagentPropertyMapper(db, cursor) prop_Name_ID_Map = propMapper.mapPropNameID() # (prop name, prop id) prop_Category_Name_ID_Map = propMapper.mapPropCategoryNameID() # currUser is an INT user ID def getCurrentUserProjects(currUser): #print "Content-type:text/html" #print # get projects user has AT LEAST Read access to (i.e. if he is explicitly declared a Writer on a project but not declared a Reader, that's allowed) currReadProj = packetHandler.findMemberProjects(currUser, 'Reader') currWriteProj = packetHandler.findMemberProjects(currUser, 'Writer') publicProj = packetHandler.findAllProjects(isPrivate="FALSE")
cursor = db.cursor() # Handlers and Mappers aHandler = AssociationHandler(db, cursor) rHandler = ReagentHandler(db, cursor) iHandler = InsertHandler(db, cursor) raHandler = ReagentAssociationHandler(db, cursor) sHandler = DNAHandler(db, cursor) pHandler = ReagentPropertyHandler(db, cursor) packetHandler = ProjectDatabaseHandler(db, cursor) uHandler = UserHandler(db, cursor) rtPropHandler = ReagentTypePropertyHandler(db, cursor) oHandler = OligoHandler(db, cursor) propMapper = ReagentPropertyMapper(db, cursor) aMapper = ReagentAssociationMapper(db, cursor) rMapper = ReagentTypeMapper(db, cursor) # Various maps reagentType_Name_ID_Map = rMapper.mapTypeNameID() reagentType_ID_Name_Map = rMapper.mapTypeIDName() assoc_Type_Name_Map = aMapper.mapAssocTypeNameID() assoc_Name_Alias_Map = aMapper.mapAssocNameAlias() assoc_Name_Type_Map = aMapper.mapAssocTypeNameID() prop_Name_ID_Map = propMapper.mapPropNameID() # (prop name, prop id) prop_ID_Name_Map = propMapper.mapPropIDName() # (prop id, prop name) prop_Name_Alias_Map = propMapper.mapPropNameAlias() # (propName, propAlias) prop_Alias_Name_Map = propMapper.mapPropAliasName() # (propAlias, propName)
dbConn = DatabaseConn() db = dbConn.databaseConnect() cursor = db.cursor() hostname = dbConn.getHostname() root_path = dbConn.getRootDir() dnaHandler = DNAHandler(db, cursor) protHandler = ProteinHandler(db, cursor) rHandler = ReagentHandler(db, cursor) pHandler = ReagentPropertyHandler(db, cursor) rtPropHandler = ReagentTypePropertyHandler(db, cursor) lHandler = LocationHandler(db, cursor) propMapper = ReagentPropertyMapper(db, cursor) rtMapper = ReagentTypeMapper(db, cursor) reagentType_Name_ID_Map = rtMapper.mapTypeNameID() prop_Name_ID_Map = propMapper.mapPropNameID() # (prop name, prop id) prop_ID_Name_Map = propMapper.mapPropIDName() # (prop id, prop name) prop_Name_Descr_Map = propMapper.mapPropNameDescription() prop_ID_Descr_Map = propMapper.mapPropIDDescription() prop_Category_Name_ID_Map = propMapper.mapPropCategoryNameID() def main(): #print "Content-type:text/html"
dbConn = DatabaseConn()
db = dbConn.databaseConnect()
cursor = db.cursor()
hostname = dbConn.getHostname()
root_path = dbConn.getRootDir()
dnaHandler = DNAHandler(db, cursor)
protHandler = ProteinHandler(db, cursor)
rHandler = ReagentHandler(db, cursor)
oHandler = OligoHandler(db, cursor)
propHandler = ReagentPropertyHandler(db, cursor)
packetHandler = ProjectDatabaseHandler(db, cursor)
propMapper = ReagentPropertyMapper(db, cursor)
prop_Name_ID_Map = propMapper.mapPropNameID() # (prop name, prop id)
prop_Category_Name_ID_Map = propMapper.mapPropCategoryNameID()
# currUser is an INT user ID
def getCurrentUserProjects(currUser):
#print "Content-type:text/html"
#print
# get projects user has AT LEAST Read access to (i.e. if he is explicitly declared a Writer on a project but not declared a Reader, that's allowed)
currReadProj = packetHandler.findMemberProjects(currUser, 'Reader')
currWriteProj = packetHandler.findMemberProjects(currUser, 'Writer')
publicProj = packetHandler.findAllProjects(isPrivate="FALSE")
def update():
dbConn = DatabaseConn()
db = dbConn.databaseConnect()
cursor = db.cursor()
hostname = dbConn.getHostname()
form = cgi.FieldStorage(keep_blank_values="True")
print "Content-type:text/html" # REMOVE AFTER DEBUGGING TO HAVE SCRIPT REDIRECT PROPERLY!!!!!!
print # DITTO
#print `form`
# Aug 29/07
uHandler = UserHandler(db, cursor)
if form.has_key("curr_username"):
# store the user ID for use throughout the session; add to other views in addition to create in PHP
currUname = form.getvalue("curr_username")
currUser = uHandler.getUserByDescription(currUname)
Session.setUser(currUser)
#else: # debug
#currUname = 'Administrator'
#currUser = uHandler.getUserByDescription(currUname)
#Session.setUser(currUser)
if form.has_key("cloning_method"):
cloning_method = form.getvalue("cloning_method")
#else: # debug
#cloning_method = '1'
# Handlers and mappers
rHandler = ReagentHandler(db, cursor)
#sHandler = SystemSetHandler(db, cursor)
pHandler = ReagentPropertyHandler(db, cursor)
raHandler = ReagentAssociationHandler(db, cursor)
aHandler = AssociationHandler(db, cursor)
dnaHandler = DNAHandler(db, cursor)
commHandler = CommentHandler(db, cursor)
protHandler = ProteinHandler(db, cursor)
propMapper = ReagentPropertyMapper(db, cursor)
assocMapper = ReagentAssociationMapper(db, cursor)
# August 29/07: Restrict creation by user and project access
packetHandler = ProjectDatabaseHandler(db, cursor)
########################################################
# Various maps
########################################################
prop_Alias_ID_Map = propMapper.mapPropAliasID() # (propAlias, propID) - e.g. ('insert_type', '48') --> represents 'type of insert' property
prop_Name_Alias_Map = propMapper.mapPropNameAlias() # (propName, propAlias)
prop_Name_ID_Map = propMapper.mapPropNameID() # (prop name, prop id)
# Restriction sites
fpcs_prop_id = pHandler.findPropID("5' cloning site")
tpcs_prop_id = pHandler.findPropID("3' cloning site")
newFivePrime = form.getvalue("fpcs")
newThreePrime = form.getvalue("tpcs")
gatewaySites = ['attb', 'attl', 'attp', 'attr'] # nov. 16/07
# resulting sequence
newSeq = ""
# Fetch projects the user has AT LEAST Read access to (i.e. if he is explicitly declared a Writer on a project but not declared a Reader, include that project, plus all public projects)
currReadProj = packetHandler.findMemberProjects(currUser.getUserID(), 'Reader')
currWriteProj = packetHandler.findMemberProjects(currUser.getUserID(), 'Writer')
publicProj = packetHandler.findAllProjects(isPrivate="FALSE")
# list of Packet OBJECTS
currUserWriteProjects = utils.unique(currReadProj + currWriteProj + publicProj)
uPackets = []
for p in currUserWriteProjects:
uPackets.append(p.getNumber())
# Get project IDs of parents
packetPropID = pHandler.findPropID("packet id")
# August 29/07: Need to verify parent project access AND (Sept. 12/07) reconstruct the sequence IFF parent values are changed
newSeq = ""
# Fetch projects the user has AT LEAST Read access to (i.e. if he is explicitly declared a Writer on a project but not declared a Reader, include that project, plus all public projects)
currReadProj = packetHandler.findMemberProjects(currUser.getUserID(), 'Reader')
currWriteProj = packetHandler.findMemberProjects(currUser.getUserID(), 'Writer')
publicProj = packetHandler.findAllProjects(isPrivate="FALSE")
# list of Packet OBJECTS
currUserWriteProjects = utils.unique(currReadProj + currWriteProj + publicProj)
uPackets = []
for p in currUserWriteProjects:
uPackets.append(p.getNumber())
# Get project IDs of parents
packetPropID = pHandler.findPropID("packet id")
if form.has_key("PV"):
pvVal = form.getvalue("PV")
if len(pvVal) > 0:
pvID = rHandler.convertReagentToDatabaseID(pvVal)
try:
pvProjectID = int(rHandler.findSimplePropertyValue(pvID, packetPropID))
pvSeqID = rHandler.findDNASequenceKey(pvID) # get sequence for reconstitution later
except TypeError:
#pvProjectID = 0
e = PVProjectAccessException("You are not authorized to use this Parent Vector, since you do not have Read access to its project.")
print `e.err_code()`
else:
e = UnknownPVIDException("Unknown Parent Vector value")
print `e.err_code()`
return
# else don't do anything, maybe want to delete parents!!!
#else:
#e = MissingPVException("No Parent Vector provided")
#print `e.err_code()`
if pvProjectID > 0 and currUser.getCategory() != 'Admin' and pvProjectID not in uPackets:
e = PVProjectAccessException("Not authorized to access parent")
print `e.err_code()`
return
if cloning_method == '1':
# Non-recombination vector - Get the Insert
if form.has_key("I"):
insertVal = form.getvalue("I")
if len(insertVal) > 0:
insertID = rHandler.convertReagentToDatabaseID(insertVal)
insertSeqID = rHandler.findDNASequenceKey(insertID) # fetch Insert sequence for reconstitution later
try:
insertProjectID = int(rHandler.findSimplePropertyValue(insertID, packetPropID))
except TypeError:
#insertProjectID = 0
e = InsertProjectAccessException("You are not authorized to use this Insert, since you do not have Read access to its project.")
print `e.err_code()`
else:
#insertID = -1
#insertProjectID = 0
#print "Invalid Insert value"
e = UnknownInsertIDException("Unknown Insert value")
print `e.err_code()`
return
#else: # NO!!!!!!!!
#e = MissingInsertException("No Insert provided")
#print `e.err_code()`
if insertProjectID > 0 and currUser.getCategory() != 'Admin' and insertProjectID not in uPackets:
e = InsertProjectAccessException("You are not authorized to use this Insert, since you do not have Read access to its project.")
print `e.err_code()`
return
if pvID > 0 and insertID > 0 :
# try to reconstruct sequence and issue warning if unable
if pvSeqID > 0 and insertSeqID > 0:
# fetch insert cloning sites
insertCloningSites = []
fpcs_prop_id = pHandler.findPropID("5' cloning site")
tpcs_prop_id = pHandler.findPropID("3' cloning site")
fp_insert_cs = rHandler.findSimplePropertyValue(insertID, fpcs_prop_id)
tp_insert_cs = rHandler.findSimplePropertyValue(insertID, tpcs_prop_id)
# Determine if this is a Gateway clone from sites
gwSites = False;
if fp_insert_cs and tp_insert_cs and fp_insert_cs.lower() == 'attl' and tp_insert_cs.lower() == 'attl':
gwSites = True
elif not fp_insert_cs or not tp_insert_cs:
gwSites = True
# nov. 16/07: added this for check
elif fp_insert_cs.lower() in gatewaySites or tp_insert_cs.lower() in gatewaySites:
gwSites = True
else:
gwSites = False;
if gwSites:
# this is a gateway clone
# if sites were changed to something other than gateway, clear sequence
if newFivePrime.lower() != 'attl' or newThreePrime.lower() != 'attl':
e = InsertSitesNotFoundOnParentSequenceException()
print `e.err_code()`
return
else:
pvSeqKey = rHandler.findDNASequenceKey(pvID)
# For Gateway clones, linkers are found from primers - so find the sense and antisense Oligos for this Insert
insertLinkers = []
# Find Sense and Antisense Oligos for this Insert
# (not using antisense just yet - verify with Karen)
iHandler = InsertHandler(db, cursor)
senseOligoID = iHandler.findSenseOligoID(insertID)
#antisenseOligoID = iHandler.findAntisenseOligoID(insert_db_id)
# Find Oligo sequences
seqPropID = pHandler.findPropID("sequence")
senseOligoSeqID = rHandler.findIndexPropertyValue(senseOligoID, seqPropID)
senseOligoSequence = dnaHandler.findSequenceByID(senseOligoSeqID)
# Fetch Insert sequence and find linkers from Oligo and Insert sequences
insertSequence = dnaHandler.findSequenceByID(insertSeqID)
attB_const = "ggggacaactttgtacaaaaaagttggc"
fwd_primer_seq = senseOligoSequence[len(attB_const):]
# First, find linkers from Oligos
fwd_linker = dnaHandler.linker_from_oligo(insertSequence, fwd_primer_seq)
#rev_linker = sHandler.linker_from_oligo(insertSequence, rev_primer_seq)
rev_linker = ""
# Now see if the Insert had its own linkers stored and append them to the Oligo linker
fpLinkerPropID = pHandler.findPropID("5' linker")
tpLinkerPropID = pHandler.findPropID("3' linker")
fp_insert_linker = rHandler.findSimplePropertyValue(insertID, fpLinkerPropID)
tp_insert_linker = rHandler.findSimplePropertyValue(insertID, tpLinkerPropID)
if fp_insert_linker and len(fp_insert_linker) > 0 and fp_insert_linker != 0 and fp_insert_linker != '0':
fp_insert_linker = fwd_linker + fp_insert_linker
else:
fp_insert_linker = fwd_linker
tp_insert_linker = rev_linker
insertLinkers.append(fp_insert_linker)
insertLinkers.append(tp_insert_linker)
try:
newSeq = dnaHandler.entryVectorSequence(pvSeqKey, insertSeqID, insertLinkers)
print newSeq
except MultipleSiteOccurrenceException:
e = MultipleSiteOccurrenceException("Sites found more than once on parent vector sequence")
print `e.err_code()`
except FivePrimeAfterThreePrimeException:
e = FivePrimeAfterThreePrimeException("5' after 3'")
print `e.err_code()`
except InsertSitesNotFoundOnParentSequenceException:
e = InsertSitesNotFoundOnParentSequenceException("Gateway sites not found on parent vector sequence")
print `e.err_code()`
else:
# Non-Gateway non-recombination Vector
fp_insert_cs = newFivePrime
tp_insert_cs = newThreePrime
if fp_insert_cs:
insertCloningSites.append(fp_insert_cs)
else:
insertCloningSites.append("")
if tp_insert_cs:
insertCloningSites.append(tp_insert_cs)
else:
insertCloningSites.append("")
# get linkers if there are any
insertLinkers = []
fpLinkerPropID = pHandler.findPropID("5' linker")
tpLinkerPropID = pHandler.findPropID("3' linker")
fp_insert_linker = rHandler.findSimplePropertyValue(insertID, fpLinkerPropID)
tp_insert_linker = rHandler.findSimplePropertyValue(insertID, tpLinkerPropID)
# sept. 3/07
fwd_linker = ""
if fp_insert_linker and len(fp_insert_linker) > 0 and fp_insert_linker != 0 and fp_insert_linker != '0':
fp_insert_linker = fwd_linker + fp_insert_linker
else:
fp_insert_linker = fwd_linker
insertLinkers.append(fp_insert_linker)
insertLinkers.append(tp_insert_linker)
try:
newSeq = dnaHandler.constructNonRecombSequence(pvSeqID, insertSeqID, insertCloningSites, insertLinkers)
print newSeq
except (InsertSitesException):
e = InsertSitesException("Could not reconstitute sequence: Unknown sites on Insert.")
print e.err_code()
except (InsertSitesNotFoundOnParentSequenceException):
e = InsertSitesNotFoundOnParentSequenceException("Could not reconstitute sequence: Parent vector sequence does not contain restriction sites.")
print e.err_code()
except (MultipleSiteOccurrenceException):
e = MultipleSiteOccurrenceException("Could not reconstitute sequence: Restriction sites occur more than once on parent vector sequence")
print e.err_code()
except (HybridizationException):
e = HybridizationException("Could not reconstitute sequence: Restriction sites cannot be hybridized.")
print e.err_code()
except (FivePrimeAfterThreePrimeException):
e = FivePrimeAfterThreePrimeException("Could not reconstitute sequence: 5' site occurs after 3' site on parent vector sequence.")
print e.err_code()
else:
e = InvalidSequenceException("Invalid parent sequence")
print `e.err_code()`
else:
e = UnknownPVIDException("Unknown PV ID")
print `e.err_code()`
elif cloning_method == '2':
# Recombination vector - check IPV
ipvVal = form.getvalue("IPV")
if len(ipvVal) > 0:
ipvID = rHandler.convertReagentToDatabaseID(ipvVal)
ipvProjectID = int(rHandler.findSimplePropertyValue(ipvID, packetPropID))
else:
e = UnknownIPVIDException("Unknown IPV ID")
print `e.err_code()`
if ipvProjectID > 0 and currUser.getCategory() != 'Admin' and ipvProjectID not in uPackets:
e = IPVProjectAccessException("Not authorized to view IPV")
print `e.err_code()`
if ipvID > 0 and pvID > 0:
# If restriction sites were modified to anything other than LoxP or gateway att sites, clear the sequence
if not (newFivePrime == newThreePrime and (newFivePrime.lower() == 'loxp' and newThreePrime.lower() == 'loxp') or (newFivePrime.lower() == 'attb' and newThreePrime.lower() == 'attb')):
e = InsertSitesNotFoundOnParentSequenceException("Invalid restriction sites for Non-Recombination Clone - must be LoxP only")
print `e.err_code()`
else:
# get internal db IDs
pv_db_id = rHandler.convertReagentToDatabaseID(pvVal)
ipv_db_id = rHandler.convertReagentToDatabaseID(ipvVal)
# Get the Insert that belongs to the donor vector
ipvInsertAssocID = raHandler.findReagentAssociationID(ipv_db_id)
insertAssocPropID = aHandler.findAssocPropID("insert id")
insert_db_id = aHandler.findAssocPropValue(ipvInsertAssocID, insertAssocPropID)
# Construct a sequence for the new vector from the sequences of its parents
pvSeqKey = rHandler.findDNASequenceKey(pv_db_id)
#print "pv seq " + `pvSeqKey`
ipvSeqKey = rHandler.findDNASequenceKey(ipv_db_id)
#print "ipv seq " + `ipvSeqKey`
insertSeqKey = rHandler.findDNASequenceKey(insert_db_id)
#print "i seq " + `insertSeqKey`
if pvSeqKey > 0 and ipvSeqKey > 0 and insertSeqKey > 0:
# See if there are linkers, although there most likely aren't any
insertLinkers = []
fpLinkerPropID = pHandler.findPropID("5' linker")
tpLinkerPropID = pHandler.findPropID("3' linker")
fp_insert_linker = rHandler.findSimplePropertyValue(insert_db_id, fpLinkerPropID)
tp_insert_linker = rHandler.findSimplePropertyValue(insert_db_id, tpLinkerPropID)
# sept. 3/07
fwd_linker = ""
if fp_insert_linker and len(fp_insert_linker) > 0 and fp_insert_linker != 0 and fp_insert_linker != '0':
fp_insert_linker = fwd_linker + fp_insert_linker
else:
fp_insert_linker = fwd_linker
insertLinkers.append(fp_insert_linker)
insertLinkers.append(tp_insert_linker)
# Differentiate by cloning sites whether this is a recombination vector or a Gateway Expression Vector
if newFivePrime == 'LoxP' and newThreePrime == 'LoxP':
# recombination
try:
newSeq = dnaHandler.constructRecombSequence(pvSeqKey, ipvSeqKey, insertSeqKey, insertLinkers)
newSeqID = dnaHandler.matchSequence(newSeq)
print newSeq
except InsertSitesNotFoundOnParentSequenceException:
e = InsertSitesNotFoundOnParentSequenceException("LOXP sites not found on parent vector sequence")
print `e.err_code()`
except MultipleSiteOccurrenceException:
e = MultipleSiteOccurrenceException("LOXP found more than once on parent vector sequence")
print `e.err_code()`
elif newFivePrime == 'attB' and newThreePrime == 'attB':
# Gateway Expression
iHandler = InsertHandler(db, cursor)
senseOligoID = iHandler.findSenseOligoID(insert_db_id)
#antisenseOligoID = iHandler.findAntisenseOligoID(insert_db_id)
# Find Oligo sequences
seqPropID = pHandler.findPropID("sequence")
senseOligoSeqID = rHandler.findIndexPropertyValue(senseOligoID, seqPropID)
senseOligoSequence = dnaHandler.findSequenceByID(senseOligoSeqID)
# Fetch Insert sequence and find linkers from Oligo and Insert sequences
insertSequence = dnaHandler.findSequenceByID(insertSeqKey)
attB_const = "ggggacaactttgtacaaaaaagttggc"
fwd_primer_seq = senseOligoSequence[len(attB_const):]
# First, find linkers from Oligos
fwd_linker = dnaHandler.linker_from_oligo(insertSequence, fwd_primer_seq)
#rev_linker = sHandler.linker_from_oligo(insertSequence, rev_primer_seq)
rev_linker = ""
# Now see if the Insert had its own linkers stored and append them to the Oligo linker
fpLinkerPropID = pHandler.findPropID("5' linker")
tpLinkerPropID = pHandler.findPropID("3' linker")
fp_insert_linker = rHandler.findSimplePropertyValue(insert_db_id, fpLinkerPropID)
tp_insert_linker = rHandler.findSimplePropertyValue(insert_db_id, tpLinkerPropID)
if fp_insert_linker and len(fp_insert_linker) > 0 and fp_insert_linker != 0 and fp_insert_linker != '0':
fp_insert_linker = fwd_linker + fp_insert_linker
else:
fp_insert_linker = fwd_linker
tp_insert_linker = rev_linker
insertLinkers.append(fp_insert_linker)
insertLinkers.append(tp_insert_linker)
try:
newSeq = dnaHandler.expressionVectorSequence(pvSeqKey, insertSeqKey, insertLinkers)
print newSeq
except MultipleSiteOccurrenceException:
e = MultipleSiteOccurrenceException("Sites found more than once on parent vector sequence")
print `e.err_code()`
except FivePrimeAfterThreePrimeException:
e = FivePrimeAfterThreePrimeException("5' after 3'")
print `e.err_code()`
except InsertSitesNotFoundOnParentSequenceException:
e = InsertSitesNotFoundOnParentSequenceException("Gateway sites not found on parent vector sequence")
print `e.err_code()`
else:
e = InvalidSequenceException("Invalid parent sequence")
print `e.err_code()`
else:
e = ReagentDoesNotExistException("Unknown parent values")
print `e.err_code()`
dbConn = DatabaseConn() db = dbConn.databaseConnect() cursor = db.cursor() hostname = dbConn.getHostname() root_path = dbConn.getRootDir() dnaHandler = DNAHandler(db, cursor) protHandler = ProteinHandler(db, cursor) rHandler = ReagentHandler(db, cursor) pHandler = ReagentPropertyHandler(db, cursor) rtPropHandler = ReagentTypePropertyHandler(db, cursor) lHandler = LocationHandler(db, cursor) propMapper = ReagentPropertyMapper(db, cursor) rtMapper = ReagentTypeMapper(db, cursor) reagentType_Name_ID_Map = rtMapper.mapTypeNameID() prop_Name_ID_Map = propMapper.mapPropNameID() # (prop name, prop id) prop_ID_Name_Map = propMapper.mapPropIDName() # (prop id, prop name) prop_Name_Descr_Map = propMapper.mapPropNameDescription() prop_ID_Descr_Map = propMapper.mapPropIDDescription() prop_Category_Name_ID_Map = propMapper.mapPropCategoryNameID() def main():
def update():
dbConn = DatabaseConn()
db = dbConn.databaseConnect()
cursor = db.cursor()
hostname = dbConn.getHostname()
form = cgi.FieldStorage(keep_blank_values="True")
print "Content-type:text/html" # REMOVE AFTER DEBUGGING TO HAVE SCRIPT REDIRECT PROPERLY!!!!!!
print # DITTO
#print `form`
# Aug 29/07
uHandler = UserHandler(db, cursor)
if form.has_key("curr_username"):
# store the user ID for use throughout the session; add to other views in addition to create in PHP
currUname = form.getvalue("curr_username")
currUser = uHandler.getUserByDescription(currUname)
Session.setUser(currUser)
#else: # debug
#currUname = 'Administrator'
#currUser = uHandler.getUserByDescription(currUname)
#Session.setUser(currUser)
if form.has_key("cloning_method"):
cloning_method = form.getvalue("cloning_method")
#else: # debug
#cloning_method = '1'
# Handlers and mappers
rHandler = ReagentHandler(db, cursor)
#sHandler = SystemSetHandler(db, cursor)
pHandler = ReagentPropertyHandler(db, cursor)
raHandler = ReagentAssociationHandler(db, cursor)
aHandler = AssociationHandler(db, cursor)
dnaHandler = DNAHandler(db, cursor)
commHandler = CommentHandler(db, cursor)
protHandler = ProteinHandler(db, cursor)
propMapper = ReagentPropertyMapper(db, cursor)
assocMapper = ReagentAssociationMapper(db, cursor)
# August 29/07: Restrict creation by user and project access
packetHandler = ProjectDatabaseHandler(db, cursor)
########################################################
# Various maps
########################################################
prop_Alias_ID_Map = propMapper.mapPropAliasID(
) # (propAlias, propID) - e.g. ('insert_type', '48') --> represents 'type of insert' property
prop_Name_Alias_Map = propMapper.mapPropNameAlias(
) # (propName, propAlias)
prop_Name_ID_Map = propMapper.mapPropNameID() # (prop name, prop id)
# Restriction sites
fpcs_prop_id = pHandler.findPropID("5' cloning site")
tpcs_prop_id = pHandler.findPropID("3' cloning site")
newFivePrime = form.getvalue("fpcs")
newThreePrime = form.getvalue("tpcs")
gatewaySites = ['attb', 'attl', 'attp', 'attr'] # nov. 16/07
# resulting sequence
newSeq = ""
# Fetch projects the user has AT LEAST Read access to (i.e. if he is explicitly declared a Writer on a project but not declared a Reader, include that project, plus all public projects)
currReadProj = packetHandler.findMemberProjects(currUser.getUserID(),
'Reader')
currWriteProj = packetHandler.findMemberProjects(currUser.getUserID(),
'Writer')
publicProj = packetHandler.findAllProjects(isPrivate="FALSE")
# list of Packet OBJECTS
currUserWriteProjects = utils.unique(currReadProj + currWriteProj +
publicProj)
uPackets = []
for p in currUserWriteProjects:
uPackets.append(p.getNumber())
# Get project IDs of parents
packetPropID = pHandler.findPropID("packet id")
# August 29/07: Need to verify parent project access AND (Sept. 12/07) reconstruct the sequence IFF parent values are changed
newSeq = ""
# Fetch projects the user has AT LEAST Read access to (i.e. if he is explicitly declared a Writer on a project but not declared a Reader, include that project, plus all public projects)
currReadProj = packetHandler.findMemberProjects(currUser.getUserID(),
'Reader')
currWriteProj = packetHandler.findMemberProjects(currUser.getUserID(),
'Writer')
publicProj = packetHandler.findAllProjects(isPrivate="FALSE")
# list of Packet OBJECTS
currUserWriteProjects = utils.unique(currReadProj + currWriteProj +
publicProj)
uPackets = []
for p in currUserWriteProjects:
uPackets.append(p.getNumber())
# Get project IDs of parents
packetPropID = pHandler.findPropID("packet id")
if form.has_key("PV"):
pvVal = form.getvalue("PV")
if len(pvVal) > 0:
pvID = rHandler.convertReagentToDatabaseID(pvVal)
try:
pvProjectID = int(
rHandler.findSimplePropertyValue(pvID, packetPropID))
pvSeqID = rHandler.findDNASequenceKey(
pvID) # get sequence for reconstitution later
except TypeError:
#pvProjectID = 0
e = PVProjectAccessException(
"You are not authorized to use this Parent Vector, since you do not have Read access to its project."
)
print ` e.err_code() `
else:
e = UnknownPVIDException("Unknown Parent Vector value")
print ` e.err_code() `
return
# else don't do anything, maybe want to delete parents!!!
#else:
#e = MissingPVException("No Parent Vector provided")
#print `e.err_code()`
if pvProjectID > 0 and currUser.getCategory(
) != 'Admin' and pvProjectID not in uPackets:
e = PVProjectAccessException("Not authorized to access parent")
print ` e.err_code() `
return
if cloning_method == '1':
# Non-recombination vector - Get the Insert
if form.has_key("I"):
insertVal = form.getvalue("I")
if len(insertVal) > 0:
insertID = rHandler.convertReagentToDatabaseID(insertVal)
insertSeqID = rHandler.findDNASequenceKey(
insertID) # fetch Insert sequence for reconstitution later
try:
insertProjectID = int(
rHandler.findSimplePropertyValue(
insertID, packetPropID))
except TypeError:
#insertProjectID = 0
e = InsertProjectAccessException(
"You are not authorized to use this Insert, since you do not have Read access to its project."
)
print ` e.err_code() `
else:
#insertID = -1
#insertProjectID = 0
#print "Invalid Insert value"
e = UnknownInsertIDException("Unknown Insert value")
print ` e.err_code() `
return
#else: # NO!!!!!!!!
#e = MissingInsertException("No Insert provided")
#print `e.err_code()`
if insertProjectID > 0 and currUser.getCategory(
) != 'Admin' and insertProjectID not in uPackets:
e = InsertProjectAccessException(
"You are not authorized to use this Insert, since you do not have Read access to its project."
)
print ` e.err_code() `
return
if pvID > 0 and insertID > 0:
# try to reconstruct sequence and issue warning if unable
if pvSeqID > 0 and insertSeqID > 0:
# fetch insert cloning sites
insertCloningSites = []
fpcs_prop_id = pHandler.findPropID("5' cloning site")
tpcs_prop_id = pHandler.findPropID("3' cloning site")
fp_insert_cs = rHandler.findSimplePropertyValue(
insertID, fpcs_prop_id)
tp_insert_cs = rHandler.findSimplePropertyValue(
insertID, tpcs_prop_id)
# Determine if this is a Gateway clone from sites
gwSites = False
if fp_insert_cs and tp_insert_cs and fp_insert_cs.lower(
) == 'attl' and tp_insert_cs.lower() == 'attl':
gwSites = True
elif not fp_insert_cs or not tp_insert_cs:
gwSites = True
# nov. 16/07: added this for check
elif fp_insert_cs.lower(
) in gatewaySites or tp_insert_cs.lower() in gatewaySites:
gwSites = True
else:
gwSites = False
if gwSites:
# this is a gateway clone
# if sites were changed to something other than gateway, clear sequence
if newFivePrime.lower() != 'attl' or newThreePrime.lower(
) != 'attl':
e = InsertSitesNotFoundOnParentSequenceException()
print ` e.err_code() `
return
else:
pvSeqKey = rHandler.findDNASequenceKey(pvID)
# For Gateway clones, linkers are found from primers - so find the sense and antisense Oligos for this Insert
insertLinkers = []
# Find Sense and Antisense Oligos for this Insert
# (not using antisense just yet - verify with Karen)
iHandler = InsertHandler(db, cursor)
senseOligoID = iHandler.findSenseOligoID(insertID)
#antisenseOligoID = iHandler.findAntisenseOligoID(insert_db_id)
# Find Oligo sequences
seqPropID = pHandler.findPropID("sequence")
senseOligoSeqID = rHandler.findIndexPropertyValue(
senseOligoID, seqPropID)
senseOligoSequence = dnaHandler.findSequenceByID(
senseOligoSeqID)
# Fetch Insert sequence and find linkers from Oligo and Insert sequences
insertSequence = dnaHandler.findSequenceByID(
insertSeqID)
attB_const = "ggggacaactttgtacaaaaaagttggc"
fwd_primer_seq = senseOligoSequence[len(attB_const):]
# First, find linkers from Oligos
fwd_linker = dnaHandler.linker_from_oligo(
insertSequence, fwd_primer_seq)
#rev_linker = sHandler.linker_from_oligo(insertSequence, rev_primer_seq)
rev_linker = ""
# Now see if the Insert had its own linkers stored and append them to the Oligo linker
fpLinkerPropID = pHandler.findPropID("5' linker")
tpLinkerPropID = pHandler.findPropID("3' linker")
fp_insert_linker = rHandler.findSimplePropertyValue(
insertID, fpLinkerPropID)
tp_insert_linker = rHandler.findSimplePropertyValue(
insertID, tpLinkerPropID)
if fp_insert_linker and len(
fp_insert_linker
) > 0 and fp_insert_linker != 0 and fp_insert_linker != '0':
fp_insert_linker = fwd_linker + fp_insert_linker
else:
fp_insert_linker = fwd_linker
tp_insert_linker = rev_linker
insertLinkers.append(fp_insert_linker)
insertLinkers.append(tp_insert_linker)
try:
newSeq = dnaHandler.entryVectorSequence(
pvSeqKey, insertSeqID, insertLinkers)
print newSeq
except MultipleSiteOccurrenceException:
e = MultipleSiteOccurrenceException(
"Sites found more than once on parent vector sequence"
)
print ` e.err_code() `
except FivePrimeAfterThreePrimeException:
e = FivePrimeAfterThreePrimeException(
"5' after 3'")
print ` e.err_code() `
except InsertSitesNotFoundOnParentSequenceException:
e = InsertSitesNotFoundOnParentSequenceException(
"Gateway sites not found on parent vector sequence"
)
print ` e.err_code() `
else:
# Non-Gateway non-recombination Vector
fp_insert_cs = newFivePrime
tp_insert_cs = newThreePrime
if fp_insert_cs:
insertCloningSites.append(fp_insert_cs)
else:
insertCloningSites.append("")
if tp_insert_cs:
insertCloningSites.append(tp_insert_cs)
else:
insertCloningSites.append("")
# get linkers if there are any
insertLinkers = []
fpLinkerPropID = pHandler.findPropID("5' linker")
tpLinkerPropID = pHandler.findPropID("3' linker")
fp_insert_linker = rHandler.findSimplePropertyValue(
insertID, fpLinkerPropID)
tp_insert_linker = rHandler.findSimplePropertyValue(
insertID, tpLinkerPropID)
# sept. 3/07
fwd_linker = ""
if fp_insert_linker and len(
fp_insert_linker
) > 0 and fp_insert_linker != 0 and fp_insert_linker != '0':
fp_insert_linker = fwd_linker + fp_insert_linker
else:
fp_insert_linker = fwd_linker
insertLinkers.append(fp_insert_linker)
insertLinkers.append(tp_insert_linker)
try:
newSeq = dnaHandler.constructNonRecombSequence(
pvSeqID, insertSeqID, insertCloningSites,
insertLinkers)
print newSeq
except (InsertSitesException):
e = InsertSitesException(
"Could not reconstitute sequence: Unknown sites on Insert."
)
print e.err_code()
except (InsertSitesNotFoundOnParentSequenceException):
e = InsertSitesNotFoundOnParentSequenceException(
"Could not reconstitute sequence: Parent vector sequence does not contain restriction sites."
)
print e.err_code()
except (MultipleSiteOccurrenceException):
e = MultipleSiteOccurrenceException(
"Could not reconstitute sequence: Restriction sites occur more than once on parent vector sequence"
)
print e.err_code()
except (HybridizationException):
e = HybridizationException(
"Could not reconstitute sequence: Restriction sites cannot be hybridized."
)
print e.err_code()
except (FivePrimeAfterThreePrimeException):
e = FivePrimeAfterThreePrimeException(
"Could not reconstitute sequence: 5' site occurs after 3' site on parent vector sequence."
)
print e.err_code()
else:
e = InvalidSequenceException("Invalid parent sequence")
print ` e.err_code() `
else:
e = UnknownPVIDException("Unknown PV ID")
print ` e.err_code() `
elif cloning_method == '2':
# Recombination vector - check IPV
ipvVal = form.getvalue("IPV")
if len(ipvVal) > 0:
ipvID = rHandler.convertReagentToDatabaseID(ipvVal)
ipvProjectID = int(
rHandler.findSimplePropertyValue(ipvID, packetPropID))
else:
e = UnknownIPVIDException("Unknown IPV ID")
print ` e.err_code() `
if ipvProjectID > 0 and currUser.getCategory(
) != 'Admin' and ipvProjectID not in uPackets:
e = IPVProjectAccessException("Not authorized to view IPV")
print ` e.err_code() `
if ipvID > 0 and pvID > 0:
# If restriction sites were modified to anything other than LoxP or gateway att sites, clear the sequence
if not (newFivePrime == newThreePrime and
(newFivePrime.lower() == 'loxp'
and newThreePrime.lower() == 'loxp') or
(newFivePrime.lower() == 'attb'
and newThreePrime.lower() == 'attb')):
e = InsertSitesNotFoundOnParentSequenceException(
"Invalid restriction sites for Non-Recombination Clone - must be LoxP only"
)
print ` e.err_code() `
else:
# get internal db IDs
pv_db_id = rHandler.convertReagentToDatabaseID(pvVal)
ipv_db_id = rHandler.convertReagentToDatabaseID(ipvVal)
# Get the Insert that belongs to the donor vector
ipvInsertAssocID = raHandler.findReagentAssociationID(
ipv_db_id)
insertAssocPropID = aHandler.findAssocPropID("insert id")
insert_db_id = aHandler.findAssocPropValue(
ipvInsertAssocID, insertAssocPropID)
# Construct a sequence for the new vector from the sequences of its parents
pvSeqKey = rHandler.findDNASequenceKey(pv_db_id)
#print "pv seq " + `pvSeqKey`
ipvSeqKey = rHandler.findDNASequenceKey(ipv_db_id)
#print "ipv seq " + `ipvSeqKey`
insertSeqKey = rHandler.findDNASequenceKey(insert_db_id)
#print "i seq " + `insertSeqKey`
if pvSeqKey > 0 and ipvSeqKey > 0 and insertSeqKey > 0:
# See if there are linkers, although there most likely aren't any
insertLinkers = []
fpLinkerPropID = pHandler.findPropID("5' linker")
tpLinkerPropID = pHandler.findPropID("3' linker")
fp_insert_linker = rHandler.findSimplePropertyValue(
insert_db_id, fpLinkerPropID)
tp_insert_linker = rHandler.findSimplePropertyValue(
insert_db_id, tpLinkerPropID)
# sept. 3/07
fwd_linker = ""
if fp_insert_linker and len(
fp_insert_linker
) > 0 and fp_insert_linker != 0 and fp_insert_linker != '0':
fp_insert_linker = fwd_linker + fp_insert_linker
else:
fp_insert_linker = fwd_linker
insertLinkers.append(fp_insert_linker)
insertLinkers.append(tp_insert_linker)
# Differentiate by cloning sites whether this is a recombination vector or a Gateway Expression Vector
if newFivePrime == 'LoxP' and newThreePrime == 'LoxP':
# recombination
try:
newSeq = dnaHandler.constructRecombSequence(
pvSeqKey, ipvSeqKey, insertSeqKey,
insertLinkers)
newSeqID = dnaHandler.matchSequence(newSeq)
print newSeq
except InsertSitesNotFoundOnParentSequenceException:
e = InsertSitesNotFoundOnParentSequenceException(
"LOXP sites not found on parent vector sequence"
)
print ` e.err_code() `
except MultipleSiteOccurrenceException:
e = MultipleSiteOccurrenceException(
"LOXP found more than once on parent vector sequence"
)
print ` e.err_code() `
elif newFivePrime == 'attB' and newThreePrime == 'attB':
# Gateway Expression
iHandler = InsertHandler(db, cursor)
senseOligoID = iHandler.findSenseOligoID(insert_db_id)
#antisenseOligoID = iHandler.findAntisenseOligoID(insert_db_id)
# Find Oligo sequences
seqPropID = pHandler.findPropID("sequence")
senseOligoSeqID = rHandler.findIndexPropertyValue(
senseOligoID, seqPropID)
senseOligoSequence = dnaHandler.findSequenceByID(
senseOligoSeqID)
# Fetch Insert sequence and find linkers from Oligo and Insert sequences
insertSequence = dnaHandler.findSequenceByID(
insertSeqKey)
attB_const = "ggggacaactttgtacaaaaaagttggc"
fwd_primer_seq = senseOligoSequence[len(attB_const):]
# First, find linkers from Oligos
fwd_linker = dnaHandler.linker_from_oligo(
insertSequence, fwd_primer_seq)
#rev_linker = sHandler.linker_from_oligo(insertSequence, rev_primer_seq)
rev_linker = ""
# Now see if the Insert had its own linkers stored and append them to the Oligo linker
fpLinkerPropID = pHandler.findPropID("5' linker")
tpLinkerPropID = pHandler.findPropID("3' linker")
fp_insert_linker = rHandler.findSimplePropertyValue(
insert_db_id, fpLinkerPropID)
tp_insert_linker = rHandler.findSimplePropertyValue(
insert_db_id, tpLinkerPropID)
if fp_insert_linker and len(
fp_insert_linker
) > 0 and fp_insert_linker != 0 and fp_insert_linker != '0':
fp_insert_linker = fwd_linker + fp_insert_linker
else:
fp_insert_linker = fwd_linker
tp_insert_linker = rev_linker
insertLinkers.append(fp_insert_linker)
insertLinkers.append(tp_insert_linker)
try:
newSeq = dnaHandler.expressionVectorSequence(
pvSeqKey, insertSeqKey, insertLinkers)
print newSeq
except MultipleSiteOccurrenceException:
e = MultipleSiteOccurrenceException(
"Sites found more than once on parent vector sequence"
)
print ` e.err_code() `
except FivePrimeAfterThreePrimeException:
e = FivePrimeAfterThreePrimeException(
"5' after 3'")
print ` e.err_code() `
except InsertSitesNotFoundOnParentSequenceException:
e = InsertSitesNotFoundOnParentSequenceException(
"Gateway sites not found on parent vector sequence"
)
print ` e.err_code() `
else:
e = InvalidSequenceException("Invalid parent sequence")
print ` e.err_code() `
else:
e = ReagentDoesNotExistException("Unknown parent values")
print ` e.err_code() `
