def printUserInfo(self, cmd, user, errCode=""):
dbConn = DatabaseConn()
hostname = dbConn.getHostname() # to define form action URL
db = dbConn.databaseConnect()
cursor = db.cursor()
uHandler = UserHandler(db, cursor)
lHandler = LabHandler(db, cursor)
pHandler = ProjectDatabaseHandler(db, cursor)
ucMapper = UserCategoryMapper(db, cursor)
category_ID_Name_Map = ucMapper.mapCategoryIDToName()
category_Name_ID_Map = ucMapper.mapCategoryNameToID()
currUser = Session.getUser()
gOut = GeneralOutputClass()
if cmd =='create':
username = user.getUsername()
firstname = user.getFirstName()
lastname = user.getLastName()
email = user.getEmail()
passwd = user.getPassword()
lab = user.getLab()
uLabID = lab.getID()
uLabName = lab.getName()
labs = lHandler.findAllLabs()
# changed Aug. 18/08 - new format
#content = gOut.printHeader() + gOut.printMainMenu()
content = gOut.printHeader()
content += '''
<FORM NAME="create_user_form" METHOD="POST" ACTION="%s" onSubmit="return verifyAddUser();">
<!-- pass current user as hidden form field -->
<INPUT type="hidden" ID="curr_username_hidden" NAME="curr_username"'''
content += "value=\"" + currUser.getFullName() + "\">"
content += '''
<TABLE width="760px" cellpadding="5" cellspacing="5">
<TH colspan="4" style="color:#0000FF; border-top:1px groove black; border-bottom: 1px groove black; padding-top: 10px; padding-top:5px;">
ADD NEW USER
<P style="color:#FF0000; font-weight:normal; font-size:8pt; margin-top:5px;">Fields in red marked with an asterisk (<span style="font-size:9pt; color:#FF0000;">*</span>) are mandatory</P>
</TH>
<TR>
<TD style="width:150px; vertical-align:top; padding-top:10px; color:#FF0000;">
Laboratory: <sup style="font-size:10pt; color:#FF0000;">*</sup>
</TD>
<TD style="vertical-align:top; padding-top:10px">
<SELECT id="labList" name="labs">
<OPTION>Select Lab</OPTION>
'''
# sort labs by name
labSortedDict = {} # will store (labName, labID) tuples
labNames = [] # just hold lab names
for labID in labs.keys():
labName = labs[labID]
labNames.append(labName)
labSortedDict[labName] = labID
labNames.sort()
#for labID in labs.keys():
for labName in labNames:
labID = labSortedDict[labName]
labName = labs[labID]
content += "<OPTION ID=\"" + `labID` + "\" NAME=\"lab_optn\" VALUE=\"" + `labID` + "\""
if labID == uLabID:
content += " SELECTED>" + labName
else:
content += ">" + labName
content += "</OPTION>"
content += '''
</SELECT>
<BR/>
<P id="lab_warning" style="color:#FF0000; display:none">Please select a laboratory name from the dropdown list above.</P>
</TD>
</TR>
<TR>
<TD class="createViewColName" style="color:#FF0000;">
Username: <sup style="font-size:10pt; color:#FF0000;">*</sup>
</TD>
<TD class="createViewColValue">
<INPUT TYPE="TEXT" SIZE="35px" id="user_name" NAME="username" VALUE="%s"/>
<BR/>
<!-- Warning anchor -->
<a name="w1" style="text-decoration:none; font-weight:normal; font-size:8pt">
<P id="dup_uname_warning" style="color:#FF0000; display:inline">This username already exists. Please specify a different username.</P>
</a>
</TD>
<TD style="font-size:8pt">
Alphanumeric string up to 10 characters used to log into the system.
</TD>
</TR>
<TR>
<TD class="createViewColName" style="color:#FF0000;">
Password: <sup style="font-size:10pt; color:#FF0000;">*</sup>
</TD>
<TD class="createViewColValue">
<INPUT TYPE="PASSWORD" SIZE="35px" id="passwd" NAME="password" VALUE="%s"/>
</TD>
</TR>
<TR>
<TD class="createViewColName" style="color:#FF0000;">
First name: <sup style="font-size:10pt; color:#FF0000;">*</sup>
</TD>
<TD class="createViewColValue">
<INPUT TYPE="TEXT" SIZE="35px" id="first_name" NAME="firstName" VALUE="%s"/>
</TD>
</TR>
<TR>
<TD class="createViewColName" style="color:#FF0000;">
Last name: <sup style="font-size:10pt; color:#FF0000;">*</sup>
</TD>
<TD class="createViewColName">
<INPUT TYPE="TEXT" SIZE="35px" id="last_name" NAME="lastName" VALUE="%s"/>
</TD>
</TR>
<TR>
<TD class="createViewColName">
Email:
</TD>
<TD class="createViewColValue">
<INPUT TYPE="TEXT" SIZE="35px" id="e_mail" NAME="email" VALUE="%s"/>
</TD>
</TR>
<TR>
<TD>
Access Level:
</TD>
<TD class="createViewColName" colspan="3">
<INPUT TYPE="RADIO" name="system_access_level" value="Reader" style="margin-top:8px; font-size:9pt" checked>Reader<BR/>
<INPUT TYPE="RADIO" name="system_access_level" value="Writer" style="margin-top:8px; font-size:9pt">Writer<BR/>
<INPUT TYPE="RADIO" name="system_access_level" value="Creator" style="margin-top:8px; font-size:9pt">Creator<BR/>
<INPUT TYPE="RADIO" name="system_access_level" value="Admin" style="margin-top:8px; font-size:9pt">Admin<BR/>
</TD>
</TR>
<TR id="project_access">
<TD colspan="4">
<TABLE width="100%%">
<TR>
<TD colspan="4" style="border-top:1px groove black; border-bottom:1px groove black; padding-top:8px; font-size:8pt; font-weight:bold">
Grant project access permissions to this user:
</TD>
</TR>
<TR>
<TD style="width:210px">
<SELECT id="packetList" name="packets" multiple size="15">
'''
# PRINT PROJECT LIST
projects = pHandler.findAllProjects()
for project in projects:
projectNumber = project.getNumber()
projectName = project.getName()
tmpProject = `projectNumber` + ": " + projectName
content += "<OPTION value=\"" + `projectNumber` + "\">" + tmpProject + "</OPTION>"
content += '''
</SELECT>
<BR/>
<INPUT TYPE="checkbox" style="margin-top:10px; font-size:8pt;" onClick="selectAll(this.id, 'packetList')" id="add_all_chkbx"> Select All</INPUT>
</TD>
<TD style="vertical-align:top" colspan="3">
<span style="font-size:8pt; font-weight:bold">User's access level to selected projects:<BR/></span>
<input type="radio" id="access_level_radio_read" name="access_levels" value="read" style="margin-top:8px; font-size:9pt" checked>Read-Only <BR/>
<input type="radio" id="access_level_radio_write" name="access_levels" value="write" style="margin-top:5px; font-size:9pt">Write <BR/>
<input style="margin-top:8px" onclick="addProjects('packetList', getSelectedRole('1'))" value="Go" type="button"></INPUT>
<P style="font-size:8pt; border-top:1px groove black; padding-top:10px; padding-bottom:5px; margin-top:10px">
Access levels: <BR/>
<span style="font-size: 8pt; margin-left: 9px; font-weight:bold; ">- Read-Only:</span> May view reagents in a project but may NOT modify them or add new reagents<BR/>
<span style="font-size: 8pt; margin-left: 9px; font-weight:bold;">- Write:</span> May create and modify reagents in a project but may NOT change project details or add/remove members to/from the project<BR/>
</P>
</TD>
</TR>
<TR>
<TD colspan="4" style="border-top:1px groove black; border-bottom:1px groove black; font-size:8pt; font-weight:bold">
User's current project access privileges:
</TD>
</TR>
<TR>
<TD style="border-right:1px solid black; font-size:8pt">
<B>Read-Only</B><BR/>
<SELECT id="user_projects_readonly" name="userProjectsReadonly" style="margin-top:5px" multiple size="12">
'''
# August 10/07: Default reader access to all on public projects
publicProjects = pHandler.findAllProjects('FALSE')
for proj in publicProjects:
pID = proj.getNumber()
pName = proj.getName();
# concatenate project ID and name in the form '1:parent'
tmpDescr = `pID` + ": " + pName
content += "<OPTION VALUE=\"" + `pID` + "\">" + tmpDescr + "</OPTION>"
content += '''
</SELECT><BR/>
<INPUT style="margin-top:10px;" TYPE="checkbox" onClick="selectAll(this.id, 'user_projects_readonly')" id="select_all_reader_chkbx"> Select All</INPUT>
</TD>
<TD style="text-align:center; width:100px; border-right: 1px solid black; padding-left:20px; padding-right:20px;">
<input onclick="addProjects('user_projects_readonly', 'write')" value=" Make Writeable >>" type="button"></INPUT><BR/>
<input style="margin-top:30px;" onclick="addProjects('user_projects_write', 'read')" value="<< Make Read-Only" type="button"></INPUT><BR/>
<input style="margin-top:30px;" onclick="addProjects('user_projects_write'); addProjects('user_projects_readonly')" value="Remove Selected" type="button"></INPUT>
</TD>
<TD style="padding-left:50px; font-size:8pt">
<B>Write</B><BR/>
<SELECT id="user_projects_write" name="userProjectsWrite" style="margin-top:5px" multiple size="12"></SELECT><BR/>
<INPUT style="margin-top:10px;" TYPE="checkbox" onClick="selectAll(this.id, 'user_projects_write')" id="select_all_writer_chkbx"> Select All</INPUT>
</TD>
</TR>
</TABLE>
</TD>
</TR>
<TR>
<TD colspan="4" style="border-top:1px groove black; border-bottom:1px groove black">
<INPUT TYPE="SUBMIT" id="addUser" NAME="add_user" VALUE="Add User" onClick="selectAllElements('user_projects_readonly'); selectAllElements('user_projects_write');">
</TD>
</TR>
</TABLE>
</FORM>
<blockquote> </blockquote>
<blockquote> </blockquote>
</div>
'''
content += gOut.printFooter()
page_content = content % (hostname + "cgi/user_request_handler.py", username, passwd, firstname, lastname, email)
print "Content-type:text/html" # THIS IS PERMANENT; DO NOT REMOVE
print # DITTO
print page_content
elif cmd == 'view':
userID = user.getUserID()
username = user.getUsername()
firstname = user.getFirstName()
lastname = user.getLastName()
email = user.getEmail()
userCat = user.getCategory()
lab = user.getLab()
labID = lab.getID()
labName = lab.getName()
# Only allow modification by admin
modify_disabled = True
if (currUser.getCategory() == 'Admin'):
modify_disabled = False
content = gOut.printHeader()
#content += gOut.printMainMenu()
content += '''
<FORM name="user_form" method="POST" action="%s">
<!-- pass current user as hidden form field -->
<INPUT type="hidden" ID="curr_username_hidden" NAME="curr_username"'''
content += "value=\"" + currUser.getFullName() + "\">"
content += '''
<TABLE width="767px" style="margin-left:2px" cellpadding="5px" cellspacing="5px" class="detailedView_tbl" border="1" frame="box" rules="none">
<TR>
<TD colspan="6" class="detailedView_heading" style="padding-left:265px">
USER DETAILS PAGE
'''
content += "<INPUT TYPE=\"submit\" style=\"margin-left:50px;\" name=\"modify_user\" value=\"Change User Details\""
if modify_disabled:
content += " disabled>"
else:
content += ">"
content += "<INPUT TYPE=\"submit\" style=\"margin-left:2px;\" name=\"delete_user\" value=\"Delete User\" onClick=\"return verifyDeleteUser();\""
if modify_disabled:
content += " disabled>"
else:
content += ">"
content += '''
</TD>
</TR>
<TR>
<TD class="projectDetailedViewName" width="50px">
Username:
</TD>
<TD class="detailedView_value" colspan="2" style="width:400px">
%s
<INPUT TYPE="hidden" name="username" value="%s">
<!-- user ID a hidden value -->
<INPUT TYPE="hidden" name="userID" value="%d">
</TD>
</TR>
<TR>
<TD class="projectDetailedViewName" width="50px">
First Name:
</TD>
<TD class="detailedView_value" colspan="2" style="width:400px">
%s
<INPUT TYPE="hidden" name="firstName" value="%s">
</TD>
</TR>
<TR>
<TD class="projectDetailedViewName" width="50px">
Last Name:
</TD>
<TD class="detailedView_value" colspan="2" style="width:400px">
%s
<INPUT TYPE="hidden" name="lastName" value="%s">
</TD>
</TR>
<TR>
<TD class="projectDetailedViewName" width="50px">
Laboratory:
</TD>
<TD class="detailedView_value" colspan="2" style="width:400px">
'''
if modify_disabled:
content += labName
else:
content += "<span class=\"linkShow\" onClick=\"redirectToLabView(" + `labID` + ");\">" + labName + "</span>"
content += '''
<INPUT TYPE="hidden" name="labID" value="%d">
<INPUT type="hidden" id="view_lab_hidden" name="view_lab">
</TD>
</TR>
<TR>
<TD class="projectDetailedViewName" width="50px">
Email:
</TD>
<TD class="detailedView_value" colspan="2" style="width:400px">
%s
<INPUT TYPE="hidden" name="email" value="%s">
</TD>
</TR>
<TR>
<TD class="projectDetailedViewName" width="50px">
Access Level:
</TD>
<TD class="detailedView_value" colspan="2" style="width:400px">
%s
<INPUT TYPE="hidden" name="system_access_level" value="%d">
</TD>
</TR>
<TR>
<TD class="projectDetailedViewName" width="50px">
Projects:
</TD>
</TR>
<TR>
<TD style="font-weight:bold; font-size:8pt; width:250px" colspan="2">
Read-Only:
</TD>
<TD style="font-weight:bold; font-size:8pt">
Write:
</TD>
</TR>
<TR>
<TD style="vertical-align:top;" colspan="2">
<UL>
'''
# show projects for the user
publicProj = pHandler.findAllProjects("FALSE")
readOnlyProj = pHandler.findMemberProjects(userID, 'Reader')
readProj = utils.merge(publicProj, readOnlyProj)
writeProj = pHandler.findMemberProjects(userID, 'Writer')
# sort read projects
readKeys = []
readSorted = {}
for r in readProj:
rProjectID = r.getNumber()
readKeys.append(rProjectID)
readSorted[rProjectID] = r
readKeys = utils.unique(readKeys)
readKeys.sort()
#for r in readProj:
for rProjectID in readKeys:
#rProjectID = r.getNumber()
r = readSorted[rProjectID]
rProjectName = r.getName()
rProjectOwner = r.getOwner()
try:
rOwnerName = rProjectOwner.getLastName()
except AttributeError:
rOwnerName = ""
#content += "<LI>" + `rProjectID` + ": " + rOwnerName + ": " + rProjectName
content += "<LI>"
content += "<span class=\"linkShow\" onClick=\"redirectToProjectDetailedView(" + `rProjectID` + ");\">" + `rProjectID` + ": " + rOwnerName + ": " + rProjectName + "</span>"
content += "</LI>"
content += '''
</UL>
</TD>
<TD style="vertical-align:top;">
<UL>
'''
# sort write projects
writeKeys = []
writeSorted = {}
for w in writeProj:
wProjectID = w.getNumber()
writeKeys.append(wProjectID)
writeSorted[wProjectID] = w
writeKeys = utils.unique(writeKeys)
writeKeys.sort()
#for w in writeProj:
for wProjectID in writeKeys:
#wProjectID = w.getNumber()
w = writeSorted[wProjectID]
wProjectName = w.getName()
wProjectOwner = w.getOwner()
wOwnerName = wProjectOwner.getLastName()
#content += "<LI>" + `wProjectID` + ": " + wProjectName
content += "<LI>"
content += "<span class=\"linkShow\" onClick=\"redirectToProjectDetailedView(" + `wProjectID` + ");\">" + `wProjectID` + ": " + wOwnerName + ": " + wProjectName + "</span>"
content += "</LI>"
content += '''
</UL>
</TD>
</TR>
</TABLE>
</FORM>
<FORM id="viewProjectForm" method="POST" action="%s">
<INPUT type="hidden" id="view_packet_hidden" name="view_packet">
<INPUT type="hidden" ID="curr_userid_hidden" NAME="curr_user_id" value="%d">
</FORM>
<blockquote> </blockquote>
<blockquote> </blockquote>
<blockquote> </blockquote>
<blockquote> </blockquote>
<blockquote> </blockquote>
<blockquote> </blockquote>
<blockquote> </blockquote>
<blockquote> </blockquote>
<blockquote> </blockquote>
<blockquote> </blockquote>
<blockquote> </blockquote>
<blockquote> </blockquote>
</div>
'''
content += gOut.printFooter()
page_content = content % (hostname + "cgi/user_request_handler.py", username, username, userID, firstname, firstname, lastname, lastname, labID, email, email, userCat, category_Name_ID_Map[userCat], hostname + "cgi/project_request_handler.py", currUser.getUserID())
print "Content-type:text/html" #
print # DITTO
print page_content
elif cmd == 'edit':
userID = user.getUserID()
username = user.getUsername()
firstname = user.getFirstName()
lastname = user.getLastName()
email = user.getEmail()
passwd = user.getPassword()
userCat = user.getCategory()
lab = user.getLab()
uLabID = lab.getID()
labName = lab.getName()
labs = lHandler.findAllLabs()
if errCode == "Dup_un":
un_warn_display = "inline"
else:
un_warn_display = "none"
content = gOut.printHeader()
#content += gOut.printMainMenu()
content += '''
<FORM name="user_form" method="POST" action="%s" onSubmit="return verifyWriteProjects();">
<!-- pass current user as hidden form field -->
<INPUT type="hidden" ID="curr_username_hidden" NAME="curr_username"'''
content += "value=\"" + currUser.getFullName() + "\">"
content += '''
<TABLE width="760px" cellpadding="5px" cellspacing="5px" style="border:1px solid black" frame="box" rules="rows">
<TR>
<TD colspan="3" style="padding-left:200px; text-align:center">
<span style="color:#0000FF; font-weight:bold">CHANGE USER INFORMATION</span>
<INPUT TYPE="submit" style="margin-left:50px;" name="save_user" value="Save" onClick="selectAllElements('user_projects_readonly'); selectAllElements('user_projects_write');">
<INPUT TYPE="submit" style="margin-left:20px;" name="cancel_user" value="Cancel">
</TD>
</TR>
<TR>
<TD class="projectDetailedViewName">
Username:
</TD>
<TD class="detailedView_value" style="width:400px">
<INPUT TYPE="text" size="50px" name="username" value="%s">
<BR/>
<!-- Warning anchor -->
<a name="w1" style="text-decoration:none; font-weight:normal; font-size:8pt">
<P id="dup_uname_warning" style="color:#FF0000; display:%s">This username already exists. Please specify a different username.</P>
</a>
<!-- user ID hidden value -->
<INPUT TYPE="hidden" name="userID" value="%d">
</TD>
</TR>
<TR>
<TD class="projectDetailedViewName">
Laboratory:
</TD>
<TD style="vertical-align:top; padding-top:10px">
<SELECT id="labList" name="labs">
'''
# sort labs by name
labSortedDict = {} # will store (labName, labID) tuples
labNames = [] # just hold lab names
for labID in labs.keys():
labName = labs[labID]
labNames.append(labName)
labSortedDict[labName] = labID
labNames.sort()
#for labID in labs.keys():
for labName in labNames:
labID = labSortedDict[labName]
labName = labs[labID]
content += "<OPTION ID=\"" + `labID` + "\" NAME=\"lab_optn\" VALUE=\"" + `labID` + "\""
if labID == uLabID:
content += " SELECTED>" + labName
else:
content += ">" + labName
content += "</OPTION>"
content += '''
</SELECT>
</TD>
</TR>
<TR>
<TD class="projectDetailedViewName">
First Name:
</TD>
<TD class="detailedView_value" colspan="2">
<INPUT TYPE="text" size="50px" name="firstName" value="%s">
</TD>
</TR>
<TR>
<TD class="projectDetailedViewName">
Last Name:
</TD>
<TD class="detailedView_value" colspan="2">
<INPUT TYPE="text" size="50px" name="lastName" value="%s">
</TD>
</TR>
<TR>
<TD class="projectDetailedViewName">
Email:
</TD>
<TD class="detailedView_value" colspan="2">
<INPUT TYPE="text" size="50px" name="email" value="%s">
</TD>
</TR>
<TR>
<TD class="projectDetailedViewName">
Access Level:
</TD>
<TD class="detailedView_value" colspan="2">
<SELECT ID="user_category" NAME="system_access_level">
'''
ucHandler = UserCategoryHandler(db, cursor)
categories = ucHandler.findAllCategories()
for cID in categories.keys():
if categories[cID] == userCat:
content += "<OPTION VALUE=\"" + `cID` + "\" SELECTED>" + categories[cID] + "</OPTION>"
else:
content += "<OPTION VALUE=\"" + `cID` + "\">" + categories[cID] + "</OPTION>"
# Don't allow addition of Writeable projects to Readers thru Modify view
if userCat == 'Reader':
write_disabled = True
else:
write_disabled = False
content += '''
</SELECT>
</TD>
</TR>
<TR>
<TD class="detailedView_value" colspan="3">
Projects user has access to:
</TD>
</TR>
<TR>
<td colspan="3">
<table width="700px">
<tr>
<TD colspan="2" style="font-size:8pt; vertical-align:top"">
Read-Only
</TD>
<TD style="font-size:8pt; vertical-align:top">
'''
if not write_disabled:
content += "Write"
else:
content += " "
content += '''
</TD>
</TR>
<TR>
<TD style="">
<SELECT id="user_projects_readonly" name="userProjectsReadonly" style="margin-top:5px" multiple size="12">
'''
# show projects for the user
readProj = pHandler.findMemberProjects(userID, 'Reader')
writeProj = pHandler.findMemberProjects(userID, 'Writer')
for r in readProj:
rProjectID = r.getNumber()
rProjectName = r.getName()
content += "<OPTION name=\"project_read\" value=\"" + `rProjectID` + "\">" + `rProjectID` + ": " + rProjectName + "</OPTION>"
content += '''
</SELECT>
<BR/>
<INPUT TYPE="checkbox" style="margin-top:10px;" onClick="selectAll(this.id, 'user_projects_readonly')" id="select_all_reader_chkbx"> Select All</INPUT>
'''
if not write_disabled:
content += '''
</TD>
<TD style="text-align:center; padding-right:15px;">
<input onclick="addProjects('user_projects_readonly', 'write')" value=" Make Writeable >>" type="button"></INPUT><BR/>
<input style="margin-top:30px;" onclick="addProjects('user_projects_write', 'read')" value="<< Make Read-Only" type="button"></INPUT><BR/>
<input type="button" style="margin-top:30px;" value="Remove" onclick="removeUserProjects();"></INPUT>
</TD>
'''
else:
content += '''
<input type="button" value="Remove Selected" onclick="removeUserProjects();"></INPUT>
'''
if not write_disabled:
content += '''
<TD style="font-size:8pt">
<SELECT id="user_projects_write" name="userProjectsWrite" style="margin-top:5px" multiple size="12">
'''
for w in writeProj:
wProjectID = w.getNumber()
wProjectName = w.getName()
content += "<OPTION name=\"project_write\" value=\"" + `wProjectID` + "\">" + `wProjectID` + ": " + wProjectName + "</OPTION>"
content += '''
</SELECT><BR/>
<INPUT style="margin-top:10px;" TYPE="checkbox" onClick="selectAll(this.id, 'user_projects_write')" id="select_all_writer_chkbx"> Select All</INPUT>
</TD>
'''
content += '''
</TR>
</table>
</td>
</tr>
<TR>
<TD class="detailedView_value" colspan="3">
Add new projects:
</TD>
</TR>
<TR>
<TD colspan="3">
<TABLE>
<TR>
<TD>
<SELECT multiple ID="packetList">
'''
# Fetch the list of read and write projects for this user and extract their IDs
readProjID = [] # list of numerical IDs of read projects
for r in readProj:
rNum = r.getNumber()
readProjID.append(rNum)
writeProjID = []
for w in writeProjID:
wNum = w.getNumber()
writeProjID.append(wNum)
allPackets = pHandler.findAllProjects()
for p in allPackets:
pID = p.getNumber()
pName = p.getName()
pOwner = p.getOwner()
#print "Content-type:text/html" # TEMPORARY, REMOVE AFTER DEBUGGING TO HAVE SCRIPT REDIRECT PROPERLY!!!!!!
#print # DITTO
#print `pOwner`
# update March 11, 2011
try:
lastName = pOwner.getLastName()
except AttributeError:
lastName = ""
#pDesc = `pID` + " : " + pOwner + " : " + pName
pDesc = `pID` + " : " + lastName + " : " + pName
if not pID in readProjID and not pID in writeProjID:
content += "<OPTION VALUE=\"" + `pID` + "\">" + pDesc
content += '''
</SELECT>
<BR>
<INPUT TYPE="checkbox" style="margin-top:10px; font-size:8pt;" onClick="selectAll(this.id, 'packetList')" id="add_all_chkbx"> Select All</INPUT>
'''
if not write_disabled:
content += '''
</TD>
<TD style="vertical-align:top">
<span style="font-size:8pt; font-weight:bold">User's access level to selected projects:<BR/></span>
<input type="radio" id="access_level_radio_read" name="access_levels" value="read" style="margin-top:8px; font-size:9pt" checked>Read-Only <BR/>
<input type="radio" id="access_level_radio_write" name="access_levels" value="write" style="margin-top:5px; font-size:9pt">Write <BR/>
<input style="margin-top:8px" onclick="addProjects('packetList', getSelectedRole('1'))" value="Add project" type="button"></INPUT>
</TD>
</TABLE>
</TD>
</TR>
'''
else:
content += '''
<input style="margin-left:5px; margin-top:8px" onclick="addProjects('packetList', 'read')" value="Add project" type="button"></INPUT>
'''
content += '''
</TR>
</TABLE>
</FORM>
<blockquote> </blockquote>
<blockquote> </blockquote>
<blockquote> </blockquote>
<blockquote> </blockquote>
<blockquote> </blockquote>
<blockquote> </blockquote>
<blockquote> </blockquote>
<blockquote> </blockquote>
<blockquote> </blockquote>
<blockquote> </blockquote>
<blockquote> </blockquote>
<blockquote> </blockquote>
</div>
'''
content += gOut.printFooter()
page_content = content % (hostname + "cgi/user_request_handler.py", username, un_warn_display, userID, firstname, lastname, email)
print "Content-type:text/html" # THIS IS PERMANENT; DO NOT REMOVE
print # DITTO
print page_content
def update():
dbConn = DatabaseConn()
db = dbConn.databaseConnect()
cursor = db.cursor()
hostname = dbConn.getHostname()
form = cgi.FieldStorage(keep_blank_values="True")
print "Content-type:text/html" # REMOVE AFTER DEBUGGING TO HAVE SCRIPT REDIRECT PROPERLY!!!!!!
print # DITTO
#print `form`
# Aug 29/07
uHandler = UserHandler(db, cursor)
if form.has_key("curr_username"):
# store the user ID for use throughout the session; add to other views in addition to create in PHP
currUname = form.getvalue("curr_username")
currUser = uHandler.getUserByDescription(currUname)
Session.setUser(currUser)
#else: # debug
#currUname = 'Administrator'
#currUser = uHandler.getUserByDescription(currUname)
#Session.setUser(currUser)
if form.has_key("cloning_method"):
cloning_method = form.getvalue("cloning_method")
#else: # debug
#cloning_method = '1'
# Handlers and mappers
rHandler = ReagentHandler(db, cursor)
#sHandler = SystemSetHandler(db, cursor)
pHandler = ReagentPropertyHandler(db, cursor)
raHandler = ReagentAssociationHandler(db, cursor)
aHandler = AssociationHandler(db, cursor)
dnaHandler = DNAHandler(db, cursor)
commHandler = CommentHandler(db, cursor)
protHandler = ProteinHandler(db, cursor)
propMapper = ReagentPropertyMapper(db, cursor)
assocMapper = ReagentAssociationMapper(db, cursor)
# August 29/07: Restrict creation by user and project access
packetHandler = ProjectDatabaseHandler(db, cursor)
########################################################
# Various maps
########################################################
prop_Alias_ID_Map = propMapper.mapPropAliasID() # (propAlias, propID) - e.g. ('insert_type', '48') --> represents 'type of insert' property
prop_Name_Alias_Map = propMapper.mapPropNameAlias() # (propName, propAlias)
prop_Name_ID_Map = propMapper.mapPropNameID() # (prop name, prop id)
# Restriction sites
fpcs_prop_id = pHandler.findPropID("5' cloning site")
tpcs_prop_id = pHandler.findPropID("3' cloning site")
newFivePrime = form.getvalue("fpcs")
newThreePrime = form.getvalue("tpcs")
gatewaySites = ['attb', 'attl', 'attp', 'attr'] # nov. 16/07
# resulting sequence
newSeq = ""
# Fetch projects the user has AT LEAST Read access to (i.e. if he is explicitly declared a Writer on a project but not declared a Reader, include that project, plus all public projects)
currReadProj = packetHandler.findMemberProjects(currUser.getUserID(), 'Reader')
currWriteProj = packetHandler.findMemberProjects(currUser.getUserID(), 'Writer')
publicProj = packetHandler.findAllProjects(isPrivate="FALSE")
# list of Packet OBJECTS
currUserWriteProjects = utils.unique(currReadProj + currWriteProj + publicProj)
uPackets = []
for p in currUserWriteProjects:
uPackets.append(p.getNumber())
# Get project IDs of parents
packetPropID = pHandler.findPropID("packet id")
# August 29/07: Need to verify parent project access AND (Sept. 12/07) reconstruct the sequence IFF parent values are changed
newSeq = ""
# Fetch projects the user has AT LEAST Read access to (i.e. if he is explicitly declared a Writer on a project but not declared a Reader, include that project, plus all public projects)
currReadProj = packetHandler.findMemberProjects(currUser.getUserID(), 'Reader')
currWriteProj = packetHandler.findMemberProjects(currUser.getUserID(), 'Writer')
publicProj = packetHandler.findAllProjects(isPrivate="FALSE")
# list of Packet OBJECTS
currUserWriteProjects = utils.unique(currReadProj + currWriteProj + publicProj)
uPackets = []
for p in currUserWriteProjects:
uPackets.append(p.getNumber())
# Get project IDs of parents
packetPropID = pHandler.findPropID("packet id")
if form.has_key("PV"):
pvVal = form.getvalue("PV")
if len(pvVal) > 0:
pvID = rHandler.convertReagentToDatabaseID(pvVal)
try:
pvProjectID = int(rHandler.findSimplePropertyValue(pvID, packetPropID))
pvSeqID = rHandler.findDNASequenceKey(pvID) # get sequence for reconstitution later
except TypeError:
#pvProjectID = 0
e = PVProjectAccessException("You are not authorized to use this Parent Vector, since you do not have Read access to its project.")
print `e.err_code()`
else:
e = UnknownPVIDException("Unknown Parent Vector value")
print `e.err_code()`
return
# else don't do anything, maybe want to delete parents!!!
#else:
#e = MissingPVException("No Parent Vector provided")
#print `e.err_code()`
if pvProjectID > 0 and currUser.getCategory() != 'Admin' and pvProjectID not in uPackets:
e = PVProjectAccessException("Not authorized to access parent")
print `e.err_code()`
return
if cloning_method == '1':
# Non-recombination vector - Get the Insert
if form.has_key("I"):
insertVal = form.getvalue("I")
if len(insertVal) > 0:
insertID = rHandler.convertReagentToDatabaseID(insertVal)
insertSeqID = rHandler.findDNASequenceKey(insertID) # fetch Insert sequence for reconstitution later
try:
insertProjectID = int(rHandler.findSimplePropertyValue(insertID, packetPropID))
except TypeError:
#insertProjectID = 0
e = InsertProjectAccessException("You are not authorized to use this Insert, since you do not have Read access to its project.")
print `e.err_code()`
else:
#insertID = -1
#insertProjectID = 0
#print "Invalid Insert value"
e = UnknownInsertIDException("Unknown Insert value")
print `e.err_code()`
return
#else: # NO!!!!!!!!
#e = MissingInsertException("No Insert provided")
#print `e.err_code()`
if insertProjectID > 0 and currUser.getCategory() != 'Admin' and insertProjectID not in uPackets:
e = InsertProjectAccessException("You are not authorized to use this Insert, since you do not have Read access to its project.")
print `e.err_code()`
return
if pvID > 0 and insertID > 0 :
# try to reconstruct sequence and issue warning if unable
if pvSeqID > 0 and insertSeqID > 0:
# fetch insert cloning sites
insertCloningSites = []
fpcs_prop_id = pHandler.findPropID("5' cloning site")
tpcs_prop_id = pHandler.findPropID("3' cloning site")
fp_insert_cs = rHandler.findSimplePropertyValue(insertID, fpcs_prop_id)
tp_insert_cs = rHandler.findSimplePropertyValue(insertID, tpcs_prop_id)
# Determine if this is a Gateway clone from sites
gwSites = False;
if fp_insert_cs and tp_insert_cs and fp_insert_cs.lower() == 'attl' and tp_insert_cs.lower() == 'attl':
gwSites = True
elif not fp_insert_cs or not tp_insert_cs:
gwSites = True
# nov. 16/07: added this for check
elif fp_insert_cs.lower() in gatewaySites or tp_insert_cs.lower() in gatewaySites:
gwSites = True
else:
gwSites = False;
if gwSites:
# this is a gateway clone
# if sites were changed to something other than gateway, clear sequence
if newFivePrime.lower() != 'attl' or newThreePrime.lower() != 'attl':
e = InsertSitesNotFoundOnParentSequenceException()
print `e.err_code()`
return
else:
pvSeqKey = rHandler.findDNASequenceKey(pvID)
# For Gateway clones, linkers are found from primers - so find the sense and antisense Oligos for this Insert
insertLinkers = []
# Find Sense and Antisense Oligos for this Insert
# (not using antisense just yet - verify with Karen)
iHandler = InsertHandler(db, cursor)
senseOligoID = iHandler.findSenseOligoID(insertID)
#antisenseOligoID = iHandler.findAntisenseOligoID(insert_db_id)
# Find Oligo sequences
seqPropID = pHandler.findPropID("sequence")
senseOligoSeqID = rHandler.findIndexPropertyValue(senseOligoID, seqPropID)
senseOligoSequence = dnaHandler.findSequenceByID(senseOligoSeqID)
# Fetch Insert sequence and find linkers from Oligo and Insert sequences
insertSequence = dnaHandler.findSequenceByID(insertSeqID)
attB_const = "ggggacaactttgtacaaaaaagttggc"
fwd_primer_seq = senseOligoSequence[len(attB_const):]
# First, find linkers from Oligos
fwd_linker = dnaHandler.linker_from_oligo(insertSequence, fwd_primer_seq)
#rev_linker = sHandler.linker_from_oligo(insertSequence, rev_primer_seq)
rev_linker = ""
# Now see if the Insert had its own linkers stored and append them to the Oligo linker
fpLinkerPropID = pHandler.findPropID("5' linker")
tpLinkerPropID = pHandler.findPropID("3' linker")
fp_insert_linker = rHandler.findSimplePropertyValue(insertID, fpLinkerPropID)
tp_insert_linker = rHandler.findSimplePropertyValue(insertID, tpLinkerPropID)
if fp_insert_linker and len(fp_insert_linker) > 0 and fp_insert_linker != 0 and fp_insert_linker != '0':
fp_insert_linker = fwd_linker + fp_insert_linker
else:
fp_insert_linker = fwd_linker
tp_insert_linker = rev_linker
insertLinkers.append(fp_insert_linker)
insertLinkers.append(tp_insert_linker)
try:
newSeq = dnaHandler.entryVectorSequence(pvSeqKey, insertSeqID, insertLinkers)
print newSeq
except MultipleSiteOccurrenceException:
e = MultipleSiteOccurrenceException("Sites found more than once on parent vector sequence")
print `e.err_code()`
except FivePrimeAfterThreePrimeException:
e = FivePrimeAfterThreePrimeException("5' after 3'")
print `e.err_code()`
except InsertSitesNotFoundOnParentSequenceException:
e = InsertSitesNotFoundOnParentSequenceException("Gateway sites not found on parent vector sequence")
print `e.err_code()`
else:
# Non-Gateway non-recombination Vector
fp_insert_cs = newFivePrime
tp_insert_cs = newThreePrime
if fp_insert_cs:
insertCloningSites.append(fp_insert_cs)
else:
insertCloningSites.append("")
if tp_insert_cs:
insertCloningSites.append(tp_insert_cs)
else:
insertCloningSites.append("")
# get linkers if there are any
insertLinkers = []
fpLinkerPropID = pHandler.findPropID("5' linker")
tpLinkerPropID = pHandler.findPropID("3' linker")
fp_insert_linker = rHandler.findSimplePropertyValue(insertID, fpLinkerPropID)
tp_insert_linker = rHandler.findSimplePropertyValue(insertID, tpLinkerPropID)
# sept. 3/07
fwd_linker = ""
if fp_insert_linker and len(fp_insert_linker) > 0 and fp_insert_linker != 0 and fp_insert_linker != '0':
fp_insert_linker = fwd_linker + fp_insert_linker
else:
fp_insert_linker = fwd_linker
insertLinkers.append(fp_insert_linker)
insertLinkers.append(tp_insert_linker)
try:
newSeq = dnaHandler.constructNonRecombSequence(pvSeqID, insertSeqID, insertCloningSites, insertLinkers)
print newSeq
except (InsertSitesException):
e = InsertSitesException("Could not reconstitute sequence: Unknown sites on Insert.")
print e.err_code()
except (InsertSitesNotFoundOnParentSequenceException):
e = InsertSitesNotFoundOnParentSequenceException("Could not reconstitute sequence: Parent vector sequence does not contain restriction sites.")
print e.err_code()
except (MultipleSiteOccurrenceException):
e = MultipleSiteOccurrenceException("Could not reconstitute sequence: Restriction sites occur more than once on parent vector sequence")
print e.err_code()
except (HybridizationException):
e = HybridizationException("Could not reconstitute sequence: Restriction sites cannot be hybridized.")
print e.err_code()
except (FivePrimeAfterThreePrimeException):
e = FivePrimeAfterThreePrimeException("Could not reconstitute sequence: 5' site occurs after 3' site on parent vector sequence.")
print e.err_code()
else:
e = InvalidSequenceException("Invalid parent sequence")
print `e.err_code()`
else:
e = UnknownPVIDException("Unknown PV ID")
print `e.err_code()`
elif cloning_method == '2':
# Recombination vector - check IPV
ipvVal = form.getvalue("IPV")
if len(ipvVal) > 0:
ipvID = rHandler.convertReagentToDatabaseID(ipvVal)
ipvProjectID = int(rHandler.findSimplePropertyValue(ipvID, packetPropID))
else:
e = UnknownIPVIDException("Unknown IPV ID")
print `e.err_code()`
if ipvProjectID > 0 and currUser.getCategory() != 'Admin' and ipvProjectID not in uPackets:
e = IPVProjectAccessException("Not authorized to view IPV")
print `e.err_code()`
if ipvID > 0 and pvID > 0:
# If restriction sites were modified to anything other than LoxP or gateway att sites, clear the sequence
if not (newFivePrime == newThreePrime and (newFivePrime.lower() == 'loxp' and newThreePrime.lower() == 'loxp') or (newFivePrime.lower() == 'attb' and newThreePrime.lower() == 'attb')):
e = InsertSitesNotFoundOnParentSequenceException("Invalid restriction sites for Non-Recombination Clone - must be LoxP only")
print `e.err_code()`
else:
# get internal db IDs
pv_db_id = rHandler.convertReagentToDatabaseID(pvVal)
ipv_db_id = rHandler.convertReagentToDatabaseID(ipvVal)
# Get the Insert that belongs to the donor vector
ipvInsertAssocID = raHandler.findReagentAssociationID(ipv_db_id)
insertAssocPropID = aHandler.findAssocPropID("insert id")
insert_db_id = aHandler.findAssocPropValue(ipvInsertAssocID, insertAssocPropID)
# Construct a sequence for the new vector from the sequences of its parents
pvSeqKey = rHandler.findDNASequenceKey(pv_db_id)
#print "pv seq " + `pvSeqKey`
ipvSeqKey = rHandler.findDNASequenceKey(ipv_db_id)
#print "ipv seq " + `ipvSeqKey`
insertSeqKey = rHandler.findDNASequenceKey(insert_db_id)
#print "i seq " + `insertSeqKey`
if pvSeqKey > 0 and ipvSeqKey > 0 and insertSeqKey > 0:
# See if there are linkers, although there most likely aren't any
insertLinkers = []
fpLinkerPropID = pHandler.findPropID("5' linker")
tpLinkerPropID = pHandler.findPropID("3' linker")
fp_insert_linker = rHandler.findSimplePropertyValue(insert_db_id, fpLinkerPropID)
tp_insert_linker = rHandler.findSimplePropertyValue(insert_db_id, tpLinkerPropID)
# sept. 3/07
fwd_linker = ""
if fp_insert_linker and len(fp_insert_linker) > 0 and fp_insert_linker != 0 and fp_insert_linker != '0':
fp_insert_linker = fwd_linker + fp_insert_linker
else:
fp_insert_linker = fwd_linker
insertLinkers.append(fp_insert_linker)
insertLinkers.append(tp_insert_linker)
# Differentiate by cloning sites whether this is a recombination vector or a Gateway Expression Vector
if newFivePrime == 'LoxP' and newThreePrime == 'LoxP':
# recombination
try:
newSeq = dnaHandler.constructRecombSequence(pvSeqKey, ipvSeqKey, insertSeqKey, insertLinkers)
newSeqID = dnaHandler.matchSequence(newSeq)
print newSeq
except InsertSitesNotFoundOnParentSequenceException:
e = InsertSitesNotFoundOnParentSequenceException("LOXP sites not found on parent vector sequence")
print `e.err_code()`
except MultipleSiteOccurrenceException:
e = MultipleSiteOccurrenceException("LOXP found more than once on parent vector sequence")
print `e.err_code()`
elif newFivePrime == 'attB' and newThreePrime == 'attB':
# Gateway Expression
iHandler = InsertHandler(db, cursor)
senseOligoID = iHandler.findSenseOligoID(insert_db_id)
#antisenseOligoID = iHandler.findAntisenseOligoID(insert_db_id)
# Find Oligo sequences
seqPropID = pHandler.findPropID("sequence")
senseOligoSeqID = rHandler.findIndexPropertyValue(senseOligoID, seqPropID)
senseOligoSequence = dnaHandler.findSequenceByID(senseOligoSeqID)
# Fetch Insert sequence and find linkers from Oligo and Insert sequences
insertSequence = dnaHandler.findSequenceByID(insertSeqKey)
attB_const = "ggggacaactttgtacaaaaaagttggc"
fwd_primer_seq = senseOligoSequence[len(attB_const):]
# First, find linkers from Oligos
fwd_linker = dnaHandler.linker_from_oligo(insertSequence, fwd_primer_seq)
#rev_linker = sHandler.linker_from_oligo(insertSequence, rev_primer_seq)
rev_linker = ""
# Now see if the Insert had its own linkers stored and append them to the Oligo linker
fpLinkerPropID = pHandler.findPropID("5' linker")
tpLinkerPropID = pHandler.findPropID("3' linker")
fp_insert_linker = rHandler.findSimplePropertyValue(insert_db_id, fpLinkerPropID)
tp_insert_linker = rHandler.findSimplePropertyValue(insert_db_id, tpLinkerPropID)
if fp_insert_linker and len(fp_insert_linker) > 0 and fp_insert_linker != 0 and fp_insert_linker != '0':
fp_insert_linker = fwd_linker + fp_insert_linker
else:
fp_insert_linker = fwd_linker
tp_insert_linker = rev_linker
insertLinkers.append(fp_insert_linker)
insertLinkers.append(tp_insert_linker)
try:
newSeq = dnaHandler.expressionVectorSequence(pvSeqKey, insertSeqKey, insertLinkers)
print newSeq
except MultipleSiteOccurrenceException:
e = MultipleSiteOccurrenceException("Sites found more than once on parent vector sequence")
print `e.err_code()`
except FivePrimeAfterThreePrimeException:
e = FivePrimeAfterThreePrimeException("5' after 3'")
print `e.err_code()`
except InsertSitesNotFoundOnParentSequenceException:
e = InsertSitesNotFoundOnParentSequenceException("Gateway sites not found on parent vector sequence")
print `e.err_code()`
else:
e = InvalidSequenceException("Invalid parent sequence")
print `e.err_code()`
else:
e = ReagentDoesNotExistException("Unknown parent values")
print `e.err_code()`
def update():
dbConn = DatabaseConn()
db = dbConn.databaseConnect()
cursor = db.cursor()
hostname = dbConn.getHostname()
form = cgi.FieldStorage(keep_blank_values="True")
print "Content-type:text/html" # REMOVE AFTER DEBUGGING TO HAVE SCRIPT REDIRECT PROPERLY!!!!!!
print # DITTO
#print `form`
# Aug 29/07
uHandler = UserHandler(db, cursor)
if form.has_key("curr_username"):
# store the user ID for use throughout the session; add to other views in addition to create in PHP
currUname = form.getvalue("curr_username")
currUser = uHandler.getUserByDescription(currUname)
Session.setUser(currUser)
#else: # debug
#currUname = 'Administrator'
#currUser = uHandler.getUserByDescription(currUname)
#Session.setUser(currUser)
if form.has_key("cloning_method"):
cloning_method = form.getvalue("cloning_method")
#else: # debug
#cloning_method = '1'
# Handlers and mappers
rHandler = ReagentHandler(db, cursor)
#sHandler = SystemSetHandler(db, cursor)
pHandler = ReagentPropertyHandler(db, cursor)
raHandler = ReagentAssociationHandler(db, cursor)
aHandler = AssociationHandler(db, cursor)
dnaHandler = DNAHandler(db, cursor)
commHandler = CommentHandler(db, cursor)
protHandler = ProteinHandler(db, cursor)
propMapper = ReagentPropertyMapper(db, cursor)
assocMapper = ReagentAssociationMapper(db, cursor)
# August 29/07: Restrict creation by user and project access
packetHandler = ProjectDatabaseHandler(db, cursor)
########################################################
# Various maps
########################################################
prop_Alias_ID_Map = propMapper.mapPropAliasID(
) # (propAlias, propID) - e.g. ('insert_type', '48') --> represents 'type of insert' property
prop_Name_Alias_Map = propMapper.mapPropNameAlias(
) # (propName, propAlias)
prop_Name_ID_Map = propMapper.mapPropNameID() # (prop name, prop id)
# Restriction sites
fpcs_prop_id = pHandler.findPropID("5' cloning site")
tpcs_prop_id = pHandler.findPropID("3' cloning site")
newFivePrime = form.getvalue("fpcs")
newThreePrime = form.getvalue("tpcs")
gatewaySites = ['attb', 'attl', 'attp', 'attr'] # nov. 16/07
# resulting sequence
newSeq = ""
# Fetch projects the user has AT LEAST Read access to (i.e. if he is explicitly declared a Writer on a project but not declared a Reader, include that project, plus all public projects)
currReadProj = packetHandler.findMemberProjects(currUser.getUserID(),
'Reader')
currWriteProj = packetHandler.findMemberProjects(currUser.getUserID(),
'Writer')
publicProj = packetHandler.findAllProjects(isPrivate="FALSE")
# list of Packet OBJECTS
currUserWriteProjects = utils.unique(currReadProj + currWriteProj +
publicProj)
uPackets = []
for p in currUserWriteProjects:
uPackets.append(p.getNumber())
# Get project IDs of parents
packetPropID = pHandler.findPropID("packet id")
# August 29/07: Need to verify parent project access AND (Sept. 12/07) reconstruct the sequence IFF parent values are changed
newSeq = ""
# Fetch projects the user has AT LEAST Read access to (i.e. if he is explicitly declared a Writer on a project but not declared a Reader, include that project, plus all public projects)
currReadProj = packetHandler.findMemberProjects(currUser.getUserID(),
'Reader')
currWriteProj = packetHandler.findMemberProjects(currUser.getUserID(),
'Writer')
publicProj = packetHandler.findAllProjects(isPrivate="FALSE")
# list of Packet OBJECTS
currUserWriteProjects = utils.unique(currReadProj + currWriteProj +
publicProj)
uPackets = []
for p in currUserWriteProjects:
uPackets.append(p.getNumber())
# Get project IDs of parents
packetPropID = pHandler.findPropID("packet id")
if form.has_key("PV"):
pvVal = form.getvalue("PV")
if len(pvVal) > 0:
pvID = rHandler.convertReagentToDatabaseID(pvVal)
try:
pvProjectID = int(
rHandler.findSimplePropertyValue(pvID, packetPropID))
pvSeqID = rHandler.findDNASequenceKey(
pvID) # get sequence for reconstitution later
except TypeError:
#pvProjectID = 0
e = PVProjectAccessException(
"You are not authorized to use this Parent Vector, since you do not have Read access to its project."
)
print ` e.err_code() `
else:
e = UnknownPVIDException("Unknown Parent Vector value")
print ` e.err_code() `
return
# else don't do anything, maybe want to delete parents!!!
#else:
#e = MissingPVException("No Parent Vector provided")
#print `e.err_code()`
if pvProjectID > 0 and currUser.getCategory(
) != 'Admin' and pvProjectID not in uPackets:
e = PVProjectAccessException("Not authorized to access parent")
print ` e.err_code() `
return
if cloning_method == '1':
# Non-recombination vector - Get the Insert
if form.has_key("I"):
insertVal = form.getvalue("I")
if len(insertVal) > 0:
insertID = rHandler.convertReagentToDatabaseID(insertVal)
insertSeqID = rHandler.findDNASequenceKey(
insertID) # fetch Insert sequence for reconstitution later
try:
insertProjectID = int(
rHandler.findSimplePropertyValue(
insertID, packetPropID))
except TypeError:
#insertProjectID = 0
e = InsertProjectAccessException(
"You are not authorized to use this Insert, since you do not have Read access to its project."
)
print ` e.err_code() `
else:
#insertID = -1
#insertProjectID = 0
#print "Invalid Insert value"
e = UnknownInsertIDException("Unknown Insert value")
print ` e.err_code() `
return
#else: # NO!!!!!!!!
#e = MissingInsertException("No Insert provided")
#print `e.err_code()`
if insertProjectID > 0 and currUser.getCategory(
) != 'Admin' and insertProjectID not in uPackets:
e = InsertProjectAccessException(
"You are not authorized to use this Insert, since you do not have Read access to its project."
)
print ` e.err_code() `
return
if pvID > 0 and insertID > 0:
# try to reconstruct sequence and issue warning if unable
if pvSeqID > 0 and insertSeqID > 0:
# fetch insert cloning sites
insertCloningSites = []
fpcs_prop_id = pHandler.findPropID("5' cloning site")
tpcs_prop_id = pHandler.findPropID("3' cloning site")
fp_insert_cs = rHandler.findSimplePropertyValue(
insertID, fpcs_prop_id)
tp_insert_cs = rHandler.findSimplePropertyValue(
insertID, tpcs_prop_id)
# Determine if this is a Gateway clone from sites
gwSites = False
if fp_insert_cs and tp_insert_cs and fp_insert_cs.lower(
) == 'attl' and tp_insert_cs.lower() == 'attl':
gwSites = True
elif not fp_insert_cs or not tp_insert_cs:
gwSites = True
# nov. 16/07: added this for check
elif fp_insert_cs.lower(
) in gatewaySites or tp_insert_cs.lower() in gatewaySites:
gwSites = True
else:
gwSites = False
if gwSites:
# this is a gateway clone
# if sites were changed to something other than gateway, clear sequence
if newFivePrime.lower() != 'attl' or newThreePrime.lower(
) != 'attl':
e = InsertSitesNotFoundOnParentSequenceException()
print ` e.err_code() `
return
else:
pvSeqKey = rHandler.findDNASequenceKey(pvID)
# For Gateway clones, linkers are found from primers - so find the sense and antisense Oligos for this Insert
insertLinkers = []
# Find Sense and Antisense Oligos for this Insert
# (not using antisense just yet - verify with Karen)
iHandler = InsertHandler(db, cursor)
senseOligoID = iHandler.findSenseOligoID(insertID)
#antisenseOligoID = iHandler.findAntisenseOligoID(insert_db_id)
# Find Oligo sequences
seqPropID = pHandler.findPropID("sequence")
senseOligoSeqID = rHandler.findIndexPropertyValue(
senseOligoID, seqPropID)
senseOligoSequence = dnaHandler.findSequenceByID(
senseOligoSeqID)
# Fetch Insert sequence and find linkers from Oligo and Insert sequences
insertSequence = dnaHandler.findSequenceByID(
insertSeqID)
attB_const = "ggggacaactttgtacaaaaaagttggc"
fwd_primer_seq = senseOligoSequence[len(attB_const):]
# First, find linkers from Oligos
fwd_linker = dnaHandler.linker_from_oligo(
insertSequence, fwd_primer_seq)
#rev_linker = sHandler.linker_from_oligo(insertSequence, rev_primer_seq)
rev_linker = ""
# Now see if the Insert had its own linkers stored and append them to the Oligo linker
fpLinkerPropID = pHandler.findPropID("5' linker")
tpLinkerPropID = pHandler.findPropID("3' linker")
fp_insert_linker = rHandler.findSimplePropertyValue(
insertID, fpLinkerPropID)
tp_insert_linker = rHandler.findSimplePropertyValue(
insertID, tpLinkerPropID)
if fp_insert_linker and len(
fp_insert_linker
) > 0 and fp_insert_linker != 0 and fp_insert_linker != '0':
fp_insert_linker = fwd_linker + fp_insert_linker
else:
fp_insert_linker = fwd_linker
tp_insert_linker = rev_linker
insertLinkers.append(fp_insert_linker)
insertLinkers.append(tp_insert_linker)
try:
newSeq = dnaHandler.entryVectorSequence(
pvSeqKey, insertSeqID, insertLinkers)
print newSeq
except MultipleSiteOccurrenceException:
e = MultipleSiteOccurrenceException(
"Sites found more than once on parent vector sequence"
)
print ` e.err_code() `
except FivePrimeAfterThreePrimeException:
e = FivePrimeAfterThreePrimeException(
"5' after 3'")
print ` e.err_code() `
except InsertSitesNotFoundOnParentSequenceException:
e = InsertSitesNotFoundOnParentSequenceException(
"Gateway sites not found on parent vector sequence"
)
print ` e.err_code() `
else:
# Non-Gateway non-recombination Vector
fp_insert_cs = newFivePrime
tp_insert_cs = newThreePrime
if fp_insert_cs:
insertCloningSites.append(fp_insert_cs)
else:
insertCloningSites.append("")
if tp_insert_cs:
insertCloningSites.append(tp_insert_cs)
else:
insertCloningSites.append("")
# get linkers if there are any
insertLinkers = []
fpLinkerPropID = pHandler.findPropID("5' linker")
tpLinkerPropID = pHandler.findPropID("3' linker")
fp_insert_linker = rHandler.findSimplePropertyValue(
insertID, fpLinkerPropID)
tp_insert_linker = rHandler.findSimplePropertyValue(
insertID, tpLinkerPropID)
# sept. 3/07
fwd_linker = ""
if fp_insert_linker and len(
fp_insert_linker
) > 0 and fp_insert_linker != 0 and fp_insert_linker != '0':
fp_insert_linker = fwd_linker + fp_insert_linker
else:
fp_insert_linker = fwd_linker
insertLinkers.append(fp_insert_linker)
insertLinkers.append(tp_insert_linker)
try:
newSeq = dnaHandler.constructNonRecombSequence(
pvSeqID, insertSeqID, insertCloningSites,
insertLinkers)
print newSeq
except (InsertSitesException):
e = InsertSitesException(
"Could not reconstitute sequence: Unknown sites on Insert."
)
print e.err_code()
except (InsertSitesNotFoundOnParentSequenceException):
e = InsertSitesNotFoundOnParentSequenceException(
"Could not reconstitute sequence: Parent vector sequence does not contain restriction sites."
)
print e.err_code()
except (MultipleSiteOccurrenceException):
e = MultipleSiteOccurrenceException(
"Could not reconstitute sequence: Restriction sites occur more than once on parent vector sequence"
)
print e.err_code()
except (HybridizationException):
e = HybridizationException(
"Could not reconstitute sequence: Restriction sites cannot be hybridized."
)
print e.err_code()
except (FivePrimeAfterThreePrimeException):
e = FivePrimeAfterThreePrimeException(
"Could not reconstitute sequence: 5' site occurs after 3' site on parent vector sequence."
)
print e.err_code()
else:
e = InvalidSequenceException("Invalid parent sequence")
print ` e.err_code() `
else:
e = UnknownPVIDException("Unknown PV ID")
print ` e.err_code() `
elif cloning_method == '2':
# Recombination vector - check IPV
ipvVal = form.getvalue("IPV")
if len(ipvVal) > 0:
ipvID = rHandler.convertReagentToDatabaseID(ipvVal)
ipvProjectID = int(
rHandler.findSimplePropertyValue(ipvID, packetPropID))
else:
e = UnknownIPVIDException("Unknown IPV ID")
print ` e.err_code() `
if ipvProjectID > 0 and currUser.getCategory(
) != 'Admin' and ipvProjectID not in uPackets:
e = IPVProjectAccessException("Not authorized to view IPV")
print ` e.err_code() `
if ipvID > 0 and pvID > 0:
# If restriction sites were modified to anything other than LoxP or gateway att sites, clear the sequence
if not (newFivePrime == newThreePrime and
(newFivePrime.lower() == 'loxp'
and newThreePrime.lower() == 'loxp') or
(newFivePrime.lower() == 'attb'
and newThreePrime.lower() == 'attb')):
e = InsertSitesNotFoundOnParentSequenceException(
"Invalid restriction sites for Non-Recombination Clone - must be LoxP only"
)
print ` e.err_code() `
else:
# get internal db IDs
pv_db_id = rHandler.convertReagentToDatabaseID(pvVal)
ipv_db_id = rHandler.convertReagentToDatabaseID(ipvVal)
# Get the Insert that belongs to the donor vector
ipvInsertAssocID = raHandler.findReagentAssociationID(
ipv_db_id)
insertAssocPropID = aHandler.findAssocPropID("insert id")
insert_db_id = aHandler.findAssocPropValue(
ipvInsertAssocID, insertAssocPropID)
# Construct a sequence for the new vector from the sequences of its parents
pvSeqKey = rHandler.findDNASequenceKey(pv_db_id)
#print "pv seq " + `pvSeqKey`
ipvSeqKey = rHandler.findDNASequenceKey(ipv_db_id)
#print "ipv seq " + `ipvSeqKey`
insertSeqKey = rHandler.findDNASequenceKey(insert_db_id)
#print "i seq " + `insertSeqKey`
if pvSeqKey > 0 and ipvSeqKey > 0 and insertSeqKey > 0:
# See if there are linkers, although there most likely aren't any
insertLinkers = []
fpLinkerPropID = pHandler.findPropID("5' linker")
tpLinkerPropID = pHandler.findPropID("3' linker")
fp_insert_linker = rHandler.findSimplePropertyValue(
insert_db_id, fpLinkerPropID)
tp_insert_linker = rHandler.findSimplePropertyValue(
insert_db_id, tpLinkerPropID)
# sept. 3/07
fwd_linker = ""
if fp_insert_linker and len(
fp_insert_linker
) > 0 and fp_insert_linker != 0 and fp_insert_linker != '0':
fp_insert_linker = fwd_linker + fp_insert_linker
else:
fp_insert_linker = fwd_linker
insertLinkers.append(fp_insert_linker)
insertLinkers.append(tp_insert_linker)
# Differentiate by cloning sites whether this is a recombination vector or a Gateway Expression Vector
if newFivePrime == 'LoxP' and newThreePrime == 'LoxP':
# recombination
try:
newSeq = dnaHandler.constructRecombSequence(
pvSeqKey, ipvSeqKey, insertSeqKey,
insertLinkers)
newSeqID = dnaHandler.matchSequence(newSeq)
print newSeq
except InsertSitesNotFoundOnParentSequenceException:
e = InsertSitesNotFoundOnParentSequenceException(
"LOXP sites not found on parent vector sequence"
)
print ` e.err_code() `
except MultipleSiteOccurrenceException:
e = MultipleSiteOccurrenceException(
"LOXP found more than once on parent vector sequence"
)
print ` e.err_code() `
elif newFivePrime == 'attB' and newThreePrime == 'attB':
# Gateway Expression
iHandler = InsertHandler(db, cursor)
senseOligoID = iHandler.findSenseOligoID(insert_db_id)
#antisenseOligoID = iHandler.findAntisenseOligoID(insert_db_id)
# Find Oligo sequences
seqPropID = pHandler.findPropID("sequence")
senseOligoSeqID = rHandler.findIndexPropertyValue(
senseOligoID, seqPropID)
senseOligoSequence = dnaHandler.findSequenceByID(
senseOligoSeqID)
# Fetch Insert sequence and find linkers from Oligo and Insert sequences
insertSequence = dnaHandler.findSequenceByID(
insertSeqKey)
attB_const = "ggggacaactttgtacaaaaaagttggc"
fwd_primer_seq = senseOligoSequence[len(attB_const):]
# First, find linkers from Oligos
fwd_linker = dnaHandler.linker_from_oligo(
insertSequence, fwd_primer_seq)
#rev_linker = sHandler.linker_from_oligo(insertSequence, rev_primer_seq)
rev_linker = ""
# Now see if the Insert had its own linkers stored and append them to the Oligo linker
fpLinkerPropID = pHandler.findPropID("5' linker")
tpLinkerPropID = pHandler.findPropID("3' linker")
fp_insert_linker = rHandler.findSimplePropertyValue(
insert_db_id, fpLinkerPropID)
tp_insert_linker = rHandler.findSimplePropertyValue(
insert_db_id, tpLinkerPropID)
if fp_insert_linker and len(
fp_insert_linker
) > 0 and fp_insert_linker != 0 and fp_insert_linker != '0':
fp_insert_linker = fwd_linker + fp_insert_linker
else:
fp_insert_linker = fwd_linker
tp_insert_linker = rev_linker
insertLinkers.append(fp_insert_linker)
insertLinkers.append(tp_insert_linker)
try:
newSeq = dnaHandler.expressionVectorSequence(
pvSeqKey, insertSeqKey, insertLinkers)
print newSeq
except MultipleSiteOccurrenceException:
e = MultipleSiteOccurrenceException(
"Sites found more than once on parent vector sequence"
)
print ` e.err_code() `
except FivePrimeAfterThreePrimeException:
e = FivePrimeAfterThreePrimeException(
"5' after 3'")
print ` e.err_code() `
except InsertSitesNotFoundOnParentSequenceException:
e = InsertSitesNotFoundOnParentSequenceException(
"Gateway sites not found on parent vector sequence"
)
print ` e.err_code() `
else:
e = InvalidSequenceException("Invalid parent sequence")
print ` e.err_code() `
else:
e = ReagentDoesNotExistException("Unknown parent values")
print ` e.err_code() `