class TestFeatureKeyFunction:
def __init__(self):
self.fasta = os.path.join(path, 'data/genes.fasta')
self.faidx = Faidx(self.fasta, key_function=get_gene_name)
self.genes = Fasta(self.fasta, key_function=get_gene_name)
def test_keys(self):
expect = ['BARD1', 'FGFR2', 'KF435149.1', 'MDM4', 'NM_000465.3', 'NM_001282543.1', 'NM_001282545.1', 'NM_001282548.1', 'NM_001282549.1', 'NR_104212.1', 'NR_104215.1', 'XM_005249642.1', 'XM_005249643.1', 'XM_005249644.1', 'XM_005249645.1', 'XM_005265507.1', 'XM_005265508.1', 'XR_241079.1', 'XR_241080.1', 'XR_241081.1']
result = sorted(self.genes.keys())
assert result == expect
def test_key_function_by_dictionary_get_key(self):
expect = 'TTGAAGATTTTGCATGCAGCAGGTGCGCAAGGTGAAATGTTCACTGTTAAA'
result = self.genes['MDM4'][100-1:150]
assert str(result) == expect
def test_key_function_by_fetch(self):
expect = 'TTGAAGATTTTGCATGCAGCAGGTGCGCAAGGTGAAATGTTCACTGTTAAA'
result = self.faidx.fetch('MDM4',
100, 150)
assert str(result) == expect
@raises(ValueError)
def test_duplicated_keys(self):
genes = Fasta(self.fasta, key_function=get_duplicated_gene_name)
def test_fetch_border_padded(self):
""" Fetch past the end of a gene entry """
faidx = Faidx('data/genes.fasta.gz', default_seq='N')
expect = 'TCNNNNNNNNNNNNNNNNNNN'
result = faidx.fetch('gi|557361099|gb|KF435150.1|', 480, 500)
print(result)
assert str(result) == expect
def test_key_function_by_fetch(self):
faidx = Faidx('data/genes.fasta',
split_char='|',
duplicate_action="drop")
expect = 'TTGAAGATTTTGCATGCAGCAGGTGCGCAAGGTGAAATGTTCACTGTTAAA'
result = faidx.fetch('KF435150.1', 100, 150)
assert str(result) == expect
def test_fetch_border(self):
""" Fetch past the end of a gene entry """
faidx = Faidx('data/genes.fasta')
expect = 'TC'
result = faidx.fetch('gi|557361099|gb|KF435150.1|',
480, 500)
assert str(result) == expect
def test_fetch_border_padded(self):
""" Fetch past the end of a gene entry """
faidx = Faidx('data/genes.fasta.gz', default_seq='N')
expect = 'TCNNNNNNNNNNNNNNNNNNN'
result = faidx.fetch('gi|557361099|gb|KF435150.1|',
480, 500)
print(result)
assert str(result) == expect
class TestFeatureBoundsCheck:
def __init__(self):
self.fasta = os.path.join(path, 'data/genes.fasta')
self.faidx = Faidx(self.fasta, default_seq='N')
def test_fetch_border_padded(self):
""" Fetch past the end of a gene entry """
expect = 'TCNNNNNNNNNNNNNNNNNNN'
result = self.faidx.fetch('KF435150.1',
480, 500)
assert str(result) == expect
class Genome(object):
def __init__(self, db):
from pyfaidx import Faidx
fa = os.path.join(app.config["DATA_FOLDER"], db, db + ".fa")
self.fasta = Faidx(fa)
def get_sequence(self, chr, start, end):
return self.fasta.fetch(chr, start, end)
def destroy(self):
self.fasta.close()
def test_fetch_whole_entry(self):
faidx = Faidx('data/genes.fasta.gz')
expect = ('ATGACATCATTTTCCACCTCTGCTCAGTGTTCAACATCTGA'
'CAGTGCTTGCAGGATCTCTCCTGGACAAATCAATCAGGTACGACCA'
'AAACTGCCGCTTTTGAAGATTTTGCATGCAGCAGGTGCGCAAGG'
'TGAAATGTTCACTGTTAAAGAGGTCATGCACTATTTAGGTCAGTACAT'
'AATGGTGAAGCAACTTTATGATCAGCAGGAGCAGCATATGGTATATTG'
'TGGTGGAGATCTTTTGGGAGAACTACTGGGACGTCAGAGCTTCTCCGTG'
'AAAGACCCAAGCCCTCTCTATGATATGCTAAGAAAGAATCTTGTCACTTT'
'AGCCACTGCTACTACAGCAAAGTGCAGAGGAAAGTTCCACTTCCAGAAAAA'
'GAACTACAGAAGACGATATCCCCACACTGCCTACCTCAGAGCATAAATGCA'
'TACATTCTAGAGAAGGTGATTGAAGTGGGAAAAAATGATGACCTGGAGGACTC')
result = faidx.fetch('gi|557361099|gb|KF435150.1|', 1, 481)
assert str(result) == expect
def load_seqs_and_annotations(protein_annotations_sqlite_db_file_path, fasta_file_path, shuffle = True, records_limit = None, verbose = True, \
log_progress_every = 10000):
if verbose:
log('Loading %s records...' %
('all' if records_limit is None else records_limit))
conn = sqlite3.connect(protein_annotations_sqlite_db_file_path)
raw_proteins_and_annotations = pd.read_sql_query('SELECT uniprot_name, complete_go_annotation_indices FROM protein_annotations' + ('' if records_limit is None else \
(' LIMIT %d' % records_limit)), conn)
if verbose:
log('Loaded %d proteins and their GO annotations (%d columns: %s)' %
(raw_proteins_and_annotations.shape +
(', '.join(raw_proteins_and_annotations.columns), )))
if shuffle:
raw_proteins_and_annotations = raw_proteins_and_annotations.sample(
frac=1, random_state=0)
if verbose:
log('Loading Faidx (%s)...' % fasta_file_path)
seqs_faidx = Faidx(fasta_file_path)
if verbose:
log('Finished loading Faidx.')
n_failed = 0
for i, (_, (uniprot_id, raw_go_annotation_indices)) in enumerate(
raw_proteins_and_annotations.iterrows()):
if verbose and i % log_progress_every == 0:
log('%d/%d' % (i, len(raw_proteins_and_annotations)), end='\r')
seq_fasta_id = 'UniRef90_%s' % uniprot_id.split('_')[0]
try:
seq = str(
seqs_faidx.fetch(seq_fasta_id, 1,
seqs_faidx.index[seq_fasta_id].rlen))
yield uniprot_id, seq, json.loads(raw_go_annotation_indices)
except KeyError:
n_failed += 1
if verbose:
log('Finished. Failed finding the sequence for %d of %d records.' %
(n_failed, len(raw_proteins_and_annotations)))
def test_fetch_whole_entry(self):
faidx = Faidx('data/genes.fasta.gz')
expect = ('ATGACATCATTTTCCACCTCTGCTCAGTGTTCAACATCTGA'
'CAGTGCTTGCAGGATCTCTCCTGGACAAATCAATCAGGTACGACCA'
'AAACTGCCGCTTTTGAAGATTTTGCATGCAGCAGGTGCGCAAGG'
'TGAAATGTTCACTGTTAAAGAGGTCATGCACTATTTAGGTCAGTACAT'
'AATGGTGAAGCAACTTTATGATCAGCAGGAGCAGCATATGGTATATTG'
'TGGTGGAGATCTTTTGGGAGAACTACTGGGACGTCAGAGCTTCTCCGTG'
'AAAGACCCAAGCCCTCTCTATGATATGCTAAGAAAGAATCTTGTCACTTT'
'AGCCACTGCTACTACAGCAAAGTGCAGAGGAAAGTTCCACTTCCAGAAAAA'
'GAACTACAGAAGACGATATCCCCACACTGCCTACCTCAGAGCATAAATGCA'
'TACATTCTAGAGAAGGTGATTGAAGTGGGAAAAAATGATGACCTGGAGGACTC')
result = faidx.fetch('gi|557361099|gb|KF435150.1|',
1, 481)
assert str(result) == expect
def test_fetch_whole_entry(self):
faidx = Faidx("data/genes.fasta")
expect = (
"ATGACATCATTTTCCACCTCTGCTCAGTGTTCAACATCTGA"
"CAGTGCTTGCAGGATCTCTCCTGGACAAATCAATCAGGTACGACCA"
"AAACTGCCGCTTTTGAAGATTTTGCATGCAGCAGGTGCGCAAGG"
"TGAAATGTTCACTGTTAAAGAGGTCATGCACTATTTAGGTCAGTACAT"
"AATGGTGAAGCAACTTTATGATCAGCAGGAGCAGCATATGGTATATTG"
"TGGTGGAGATCTTTTGGGAGAACTACTGGGACGTCAGAGCTTCTCCGTG"
"AAAGACCCAAGCCCTCTCTATGATATGCTAAGAAAGAATCTTGTCACTTT"
"AGCCACTGCTACTACAGCAAAGTGCAGAGGAAAGTTCCACTTCCAGAAAAA"
"GAACTACAGAAGACGATATCCCCACACTGCCTACCTCAGAGCATAAATGCA"
"TACATTCTAGAGAAGGTGATTGAAGTGGGAAAAAATGATGACCTGGAGGACTC"
)
result = faidx.fetch("gi|557361099|gb|KF435150.1|", 1, 482)
assert str(result) == expect
class TestFeatureBoundsCheck:
def __init__(self):
self.fasta = os.path.join(path, 'data/genes.fasta')
self.faidx = Faidx(self.fasta)
self.faidx_strict = Faidx(self.fasta, strict_bounds=True)
def test_fetch_whole_entry(self):
expect = ('ATGACATCATTTTCCACCTCTGCTCAGTGTTCAACATCTGA'
'CAGTGCTTGCAGGATCTCTCCTGGACAAATCAATCAGGTACGACCA'
'AAACTGCCGCTTTTGAAGATTTTGCATGCAGCAGGTGCGCAAGG'
'TGAAATGTTCACTGTTAAAGAGGTCATGCACTATTTAGGTCAGTACAT'
'AATGGTGAAGCAACTTTATGATCAGCAGGAGCAGCATATGGTATATTG'
'TGGTGGAGATCTTTTGGGAGAACTACTGGGACGTCAGAGCTTCTCCGTG'
'AAAGACCCAAGCCCTCTCTATGATATGCTAAGAAAGAATCTTGTCACTTT'
'AGCCACTGCTACTACAGCAAAGTGCAGAGGAAAGTTCCACTTCCAGAAAAA'
'GAACTACAGAAGACGATATCCCCACACTGCCTACCTCAGAGCATAAATGCA'
'TACATTCTAGAGAAGGTGATTGAAGTGGGAAAAAATGATGACCTGGAGGACTC')
result = self.faidx.fetch('KF435150.1',
1, 482)
assert str(result) == expect
def test_fetch_middle(self):
expect = 'TTGAAGATTTTGCATGCAGCAGGTGCGCAAGGTGAAATGTTCACTGTTAAA'
result = self.faidx.fetch('KF435150.1',
100, 150)
assert str(result) == expect
def test_fetch_end(self):
expect = 'TC'
result = self.faidx.fetch('KF435150.1',
480, 482)
assert str(result) == expect
def test_fetch_border(self):
""" Fetch past the end of a gene entry """
expect = 'TC'
result = self.faidx.fetch('KF435150.1',
480, 500)
assert str(result) == expect
def test_rev(self):
expect = 'GA'
result = self.faidx.fetch('KF435150.1',
480, 482)
assert str(-result) == expect, result
@raises(FetchError)
def test_fetch_past_bounds(self):
""" Fetch past the end of a gene entry """
expect = 'TC'
result = self.faidx_strict.fetch('KF435150.1',
480, 5000)
def test_key_function_by_fetch(self):
faidx = Faidx('data/genes.fasta', key_function=get_gene_name)
expect = 'TTGAAGATTTTGCATGCAGCAGGTGCGCAAGGTGAAATGTTCACTGTTAAA'
result = faidx.fetch('MDM4',
100, 150)
assert str(result) == expect
def test_fetch_reversed_coordinates(self):
""" Fetch starting with a negative coordinate """
faidx = Faidx("data/genes.fasta", strict_bounds=True)
result = faidx.fetch("gi|557361099|gb|KF435150.1|", 50, 10)
def test_fetch_keyerror(self):
""" Fetch a key that does not exist """
faidx = Faidx("data/genes.fasta", strict_bounds=True)
result = faidx.fetch("gi|joe|gb|KF435150.1|", 1, 10)
def profile(self,
input_vcf_file,
ref_genome_file,
output_file,
raw_gt_format="GTR",
sample_id=None,
):
# unzip decompose and clean vcf file
clean_vcf_file = join_path(mkdtemp(), "clean.vcf")
if input_vcf_file.endswith(".gz"):
cmd = "gunzip -c " + input_vcf_file
else:
cmd = "cat " + input_vcf_file
cmd += " | vt decompose -s -"
cmd += " | grep -Pv \"\t\*\t\""
cmd += " | grep -v \"\\x3b\""
cmd += " | grep -v \"^M\""
cmd += " > " + clean_vcf_file
p, stdout_data = exec_sh(cmd, silent=True)
# parse the clean vcf file for the required fields
vcf_query_format = "'"
vcf_query_format += "%CHROM"
vcf_query_format += "\t%POS"
vcf_query_format += "\t%REF"
vcf_query_format += "\t%ALT"
vcf_query_format += "[\t%SAMPLE=%" + raw_gt_format + "]"
vcf_query_format += "\n"
vcf_query_format += "'"
cmd = "vcf-query"
cmd += " -f " + vcf_query_format
cmd += " " + clean_vcf_file
p, stdout_data = exec_sh(cmd, silent=True)
# get list of smaple id and prepare data structure
first_variant_record = stdout_data.decode('utf-8').split("\n")[0]
variant_items = first_variant_record.strip().split("\t")
samples_features = {}
for sample_idx in range(4, len(variant_items)):
gt_data = variant_items[sample_idx]
m = re.match(r"(?P<sample_id>.*)=(?P<raw_gt>.*)", gt_data)
sample_id = m.group("sample_id")
samples_features[sample_id] = copy.deepcopy(SNV_FEATURES_TEMPLATE)
# iterate over all vcf record and count variants for each sample
fa = Faidx(ref_genome_file)
for variant_record in stdout_data.decode('utf-8').split("\n"):
variant_items = variant_record.strip().split("\t")
if len(variant_items) < 4:
continue
chrom = variant_items[0]
pos = variant_items[1]
ref = variant_items[2]
alt = variant_items[3]
if len(ref) > 1:
continue
if ref == "-":
continue
if len(alt) > 1:
continue
if alt == "-":
continue
triplet = fa.fetch(chrom, int(pos)-1, int(pos)+1).seq
feature_id = SNV_FEATURES_HASH[ref][alt][triplet]
# iterate over all samples in the record
for sample_idx in range(4, len(variant_items)):
gt_data = variant_items[sample_idx]
m = re.match(r"(?P<sample_id>.*)=(?P<raw_gt>.*)", gt_data)
raw_gt = m.group("raw_gt")
if raw_gt == "0/0":
continue
samples_features[m.group("sample_id")][feature_id][FEATURE_QUANTITY] += 1
fa.close()
# write output feature file
with open(output_file, "w") as f_o:
header = VARIANT_TYPE
header += "\t" + VARIANT_SUBGROUP
header += "\t" + FEATURE_ID
for sample_id in samples_features:
header += "\t" + sample_id
f_o.write(header+"\n")
for feature_id in SNV_FEATURES_TEMPLATE:
feature_info = "{:s}\t{:s}\t{:s}".format(SNV_FEATURES_TEMPLATE[feature_id][VARIANT_TYPE],
SNV_FEATURES_TEMPLATE[feature_id][VARIANT_SUBGROUP],
feature_id,
)
for sample_id in samples_features:
feature_info += "\t" + str(samples_features[sample_id][feature_id][FEATURE_QUANTITY])
f_o.write(feature_info + "\n")
self.info()
self.info("Done!! The output file is at " + output_file)
def test_fetch_past_bounds(self):
""" Fetch past the end of a gene entry """
faidx = Faidx("data/genes.fasta", strict_bounds=True)
result = faidx.fetch("gi|557361099|gb|KF435150.1|", 480, 5000)
def test_fetch_reversed_coordinates(self):
""" Fetch starting with a negative coordinate """
faidx = Faidx('data/genes.fasta.gz', strict_bounds=True)
result = faidx.fetch('gi|557361099|gb|KF435150.1|', 50, 10)
def test_issue_74_end_faidx(self):
f0 = Faidx('data/genes.fasta.gz', one_based_attributes=False)
f1 = Faidx('data/genes.fasta.gz', one_based_attributes=True)
end0 = f0.fetch('gi|557361099|gb|KF435150.1|', 1, 90).end
end1 = f1.fetch('gi|557361099|gb|KF435150.1|', 1, 90).end
assert end0 == end1
def test_fetch_end(self):
faidx = Faidx('data/genes.fasta')
expect = 'TC'
result = faidx.fetch('gi|557361099|gb|KF435150.1|',
480, 481)
assert str(result) == expect
def test_rev(self):
faidx = Faidx('data/genes.fasta.gz')
expect = 'GA'
result = faidx.fetch('gi|557361099|gb|KF435150.1|', 480, 481)
assert str(-result) == expect, result
def test_fetch_middle(self):
faidx = Faidx('data/genes.fasta.gz')
expect = 'TTGAAGATTTTGCATGCAGCAGGTGCGCAAGGTGAAATGTTCACTGTTAAA'
result = faidx.fetch('gi|557361099|gb|KF435150.1|',
100, 150)
assert str(result) == expect
fa = Faidx(ref_fasta)
# downloaded from ftp://ftp.1000genomes.ebi.ac.uk/vol1/ftp/technical/reference/phase2_reference_assembly_sequence
vcf_data = pd.read_csv(vcf_filename, sep='\t', comment='&')
vcf_data = vcf_data.assign(chromosome=vcf_data['#CHROM'].astype(int))
vcf_data = vcf_data.assign(position=vcf_data['POS'].astype(int))
vcf_data = vcf_data.assign(mutation_id=vcf_data.chromosome.astype(str) + '_' +
vcf_data.position.astype(str) + '_' +
vcf_data.REF + vcf_data.ALT)
vcf_data = vcf_data.assign(ref_counts=vcf_data.tumor.str.split(':').str[1].
str.split(',').str[0].astype(int))
vcf_data = vcf_data.assign(var_counts=vcf_data.tumor.str.split(':').str[1].
str.split(',').str[1].astype(int))
vcf_data = vcf_data.assign(triplet=vcf_data.apply(
lambda x: fa.fetch(str(x.chromosome), x.position-1, x.position+1).seq,
axis=1))
vcf_data = vcf_data.assign(pattern=pd.Categorical(
vcf_data.apply(get_context, axis=1),
categories=PAT_LIST, ordered=True))
vcf_data = vcf_data.assign(
trinucleotide=pd.Categorical(
vcf_data.apply(lambda x: PAT_LIST.index(x['pattern']),
axis=1),
categories=list(range(len(PAT_LIST))), ordered=True))
foldername = 'salcedo_dream_challenge/{}_{}'.format(tumor, seq_depth)
pathlib.Path(foldername).mkdir(parents=True, exist_ok=True)
vcf_data.to_csv(
'{}/unrestricted_input_mut.csv'.format(foldername), sep='\t')
cnv_table = pd.read_csv(cnv_filename, sep='\t')
def test_rev(self):
faidx = Faidx('data/genes.fasta.gz')
expect = 'GA'
result = faidx.fetch('gi|557361099|gb|KF435150.1|',
480, 481)
assert str(-result) == expect, result
def test_fetch_end(self):
faidx = Faidx('data/genes.fasta')
expect = 'TC'
result = faidx.fetch('gi|557361099|gb|KF435150.1|', 480, 482)
assert str(result) == expect
def test_issue_74_end_faidx(self):
f0 = Faidx('data/genes.fasta.gz', one_based_attributes=False)
f1 = Faidx('data/genes.fasta.gz', one_based_attributes=True)
end0 = f0.fetch('gi|557361099|gb|KF435150.1|', 1, 90).end
end1 = f1.fetch('gi|557361099|gb|KF435150.1|', 1, 90).end
assert end0 == end1
def test_fetch_border(self):
""" Fetch past the end of a gene entry """
faidx = Faidx('data/genes.fasta')
expect = 'TC'
result = faidx.fetch('gi|557361099|gb|KF435150.1|', 480, 500)
assert str(result) == expect
def test_fetch_negative(self):
""" Fetch starting with a negative coordinate """
faidx = Faidx('data/genes.fasta.gz', strict_bounds=True)
result = faidx.fetch('gi|557361099|gb|KF435150.1|',
-10, 10)
class GFF(object):
def __init__(self, file, target):
self.file = file # this is the .gff file
self.target = target # this is the file that it is an annotation of
self.read_gff_file()
self.faidx = Faidx(target)
def read_gff_file(self):
assert self.file
l = []
with open(self.file, 'r') as f:
for line in f:
if line[0] != '#':
line = line.rstrip()
l.append(line.split('\t'))
self.df = pd.DataFrame(
l,
columns='seqid source type start end score strand phase attributes'
.split())
def build_genes(self):
"""
For the entries that have type == gene
"""
self.genes = self.df[self.df['type'].isin(['gene', 'exon', 'mRNA'])]
self.genes['gene'] = self.genes['attributes'].apply(gene_name_parse)
self.genes['geneID'] = self.genes['attributes'].apply(gene_id_parse)
self.genes['biotype'] = self.genes['attributes'].apply(biotype_parse)
def find_genes(self, genelist):
"""
Input: list of genes to query
Returns : self.genes info for those genes
"""
return self.genes[self.genes['gene'].isin(genelist)]
def retrieve_gene_sequence(self, gene):
start = int(
self.genes[(self.genes['gene'] == gene)
& (self.genes.type == 'gene')]['start'].values[0])
end = int(self.genes[(self.genes['gene'] == gene)
& (self.genes.type == 'gene')]['end'].values[0])
source = str(
self.genes[(self.genes['gene'] == gene)
& (self.genes.type == 'gene')]['seqid'].values[0])
strand = str(
self.genes[(self.genes['gene'] == gene)
& (self.genes.type == 'gene')]['strand'].values[0])
# add buffers for sequencing primers
start -= 1000
end += 1000
seq = str(self.faidx.fetch(source, start, end))
if strand == '-':
seq = self.reverse_comp(seq)
return seq
def retrieve_gene_structures(self, gene):
"""
Input
- gene : str
Returns
- fasta_dict :
keys are gene;transcript;segment_type;start;stop;strand
values are sequences
"""
def reverse_comp(self, seq):
"""
Returns the reverse complmiment of a DNA sequence
"""
d = {'A': 'T', 'G': 'C', 'C': 'G', 'T': 'A', 'N': 'N'}
new_seq = ''
for base in seq:
new_seq += d[base.upper()]
return new_seq[::-1]
def test_fetch_middle(self):
faidx = Faidx("data/genes.fasta")
expect = "TTGAAGATTTTGCATGCAGCAGGTGCGCAAGGTGAAATGTTCACTGTTAAA"
result = faidx.fetch("gi|557361099|gb|KF435150.1|", 100, 150)
assert str(result) == expect
def test_fetch_middle(self):
faidx = Faidx('data/genes.fasta.gz')
expect = 'TTGAAGATTTTGCATGCAGCAGGTGCGCAAGGTGAAATGTTCACTGTTAAA'
result = faidx.fetch('gi|557361099|gb|KF435150.1|', 100, 150)
assert str(result) == expect
def test_fetch_end(self):
faidx = Faidx("data/genes.fasta")
expect = "TC"
result = faidx.fetch("gi|557361099|gb|KF435150.1|", 480, 482)
assert str(result) == expect
def test_fetch_past_bounds(self):
""" Fetch past the end of a gene entry """
faidx = Faidx('data/genes.fasta.gz', strict_bounds=True)
result = faidx.fetch('gi|557361099|gb|KF435150.1|', 480, 5000)
def test_key_function_by_fetch(self):
faidx = Faidx('data/genes.fasta', split_char='|')
expect = 'TTGAAGATTTTGCATGCAGCAGGTGCGCAAGGTGAAATGTTCACTGTTAAA'
result = faidx.fetch('KF435150.1',
100, 150)
assert str(result) == expect
def test_fetch_keyerror(self):
""" Fetch a key that does not exist """
faidx = Faidx('data/genes.fasta.gz', strict_bounds=True)
result = faidx.fetch('gi|joe|gb|KF435150.1|', 1, 10)
def test_rev(self):
faidx = Faidx("data/genes.fasta")
expect = "GA"
result = faidx.fetch("gi|557361099|gb|KF435150.1|", 480, 482)
assert str(-result) == expect, result
def test_fetch_border(self):
""" Fetch past the end of a gene entry """
faidx = Faidx("data/genes.fasta")
expect = "TC"
result = faidx.fetch("gi|557361099|gb|KF435150.1|", 480, 500)
assert str(result) == expect
#! /usr/bin/env python3 """ gff output line 26973 NC_000001.11 BestRefSeq%2CGnomon gene 11980181 12013515 . + . ID=gene-MFN2;Dbxref=GeneID:9927,HGNC:HGNC:1687... MFN2 9927 protein_coding """ from pyfaidx import Faidx file = '/Users/jacob.cooper/resources/genomes/GRCh38_latest_genomic.fasta' chromosome = 'NC_000001.11' start = 11980181 end = 12013515 fa = Faidx(file) print(fa.fetch(chromosome, start, end))
