def test_store_cluster(self): """store_clusters stores the centroid seqs for each cluster.""" self.tmpdir = get_tmp_filename(tmp_dir="./", suffix="_store_clusters/") create_dir(self.tmpdir) self.files_to_remove.append(self.tmpdir+"singletons.fasta") self.files_to_remove.append(self.tmpdir+"centroids.fasta") #empty map results in empty files store_clusters({}, self.tiny_test, self.tmpdir) actual_centroids = list(MinimalFastaParser(open(self.tmpdir+"centroids.fasta"))) self.assertEqual(actual_centroids, []) actual_singletons = list(MinimalFastaParser(open(self.tmpdir+"singletons.fasta"))) self.assertEqual(actual_singletons, []) #non-empty map creates non-empty files, centroids sorted by size mapping = {'FZTHQMS01B8T1H':[], 'FZTHQMS01DE1KN':['FZTHQMS01EHAJG'], 'FZTHQMS01EHAJG':[1,2,3]} # content doesn't really matter centroids = [('FZTHQMS01EHAJG | cluster size: 4', 'CATGCTGCCTCCCGTAGGAGTTTGGACCGTGTCTCAGTTCCAATGTGGGGGACCTTCCTCTCAGAACCCCTATCCATCGAAGGTTTGGTGAGCCGTTACCTCACCAACTGCCTAATGGAACGCATCCCCATCGATAACCGAAATTCTTTAATAACAAGACCATGCGGTCTGATTATACCATCGGGTATTAATCTTTCTTTCGAAAGGCTATCCCCGAGTTATCGGCAGGTTGGATACGTGTTACTCACCCGTGCGCCGGTCGCCA'), ('FZTHQMS01DE1KN | cluster size: 2','CATGCTGCCTCCCGTAGGAGTTTGGACCGTGTCTCAGTTCCAATGTGGGGGACCTTCCTCTCAGAACCCCTATCCATCGAAGGTTTGGTGAGCCGTTACCTCACCAACTGCCTAATGGAACGCATCCCCATCGATAACCGAAATTCTTTAATAACAAGACCATGCGGTCTGATTATACCATCGGGTATTAATCTTTCTTTCGAAAGGCTATCCCCGAGTTATCGGCAGGTTGGATACGTGTTACTCACCCGTGCGCCGGTCGCCA')] singletons= [('FZTHQMS01B8T1H', 'CATGCTGCCTCCCGTAGGAGTTTGGACCGTGTCTCAGTTCCAATGTGGGGGACCTTCCTCTCAGAACCCCTATCCATCGAAGGTTTGGTGAGCCGTTACCTCACCAACTGCCTAATGGAACGCATCCCCATCGATAACCGAAATTCTTTAATAATTAAACCATGCGGTTTTATTATACCATCGGGTATTAATCTTTCTTTCGAAAGGCTATCCCCGAGTTATCGGCAGGTTGGATACGTGTTACTCACCCGTGCGCCGGTCGCCATCACTTA')] store_clusters(mapping, self.tiny_test, self.tmpdir) actual_centroids = list(MinimalFastaParser(open(self.tmpdir+"centroids.fasta"))) self.assertEqual(actual_centroids, centroids) actual_singletons = list(MinimalFastaParser(open(self.tmpdir+"singletons.fasta"))) self.assertEqual(actual_singletons,singletons)
def denoise_seqs( sff_fps, fasta_fp, tmpoutdir, preprocess_fp=None, cluster=False, num_cpus=1, squeeze=True, percent_id=0.97, bail=1, primer="", low_cutoff=3.75, high_cutoff=4.5, log_fp="denoiser.log", low_memory=False, verbose=False, error_profile=DENOISER_DATA_DIR + 'FLX_error_profile.dat', max_num_rounds=None, titanium=False, checkpoint_fp=None): """The main routine to denoise flowgrams""" # abort if binary is missing check_flowgram_ali_exe() if verbose: # switch of buffering for log file log_fh = open(tmpoutdir + "/" + log_fp, "w", 0) else: log_fh = None # overwrite settings if titanium is set # This flag is only used from qiime. Remove after qiime integration if titanium: error_profile = DENOISER_DATA_DIR + "Titanium_error_profile.dat" low_cutoff = 4 high_cutoff = 5 if verbose: log_fh.write("Denoiser version: %s\n" % __version__) log_fh.write("SFF files: %s\n" % ', '.join(sff_fps)) log_fh.write("Fasta file: %s\n" % fasta_fp) log_fh.write("Preprocess dir: %s\n" % preprocess_fp) if checkpoint_fp: log_fh.write("Resuming denoiser from %s\n" % checkpoint_fp) log_fh.write("Primer sequence: %s\n" % primer) log_fh.write("Running on cluster: %s\n" % cluster) log_fh.write("Num CPUs: %d\n" % num_cpus) log_fh.write("Squeeze Seqs: %s\n" % squeeze) log_fh.write("tmpdir: %s\n" % tmpoutdir) log_fh.write("percent_id threshold: %.2f\n" % percent_id) log_fh.write("Minimal sequence coverage for first phase: %d\n" % bail) log_fh.write("Low cut-off: %.2f\n" % low_cutoff) log_fh.write("High cut-off: %.2f\n" % high_cutoff) log_fh.write("Error profile: %s\n" % error_profile) log_fh.write("Maximal number of iteration: %s\n\n" % max_num_rounds) # here we go ... # Phase I - clean up and truncate input sff if(checkpoint_fp): if (preprocess_fp): # skip preprocessing as we should have data # we already have preprocessed data, so use it (deprefixed_sff_fp, l, mapping, seqs) = read_preprocessed_data(preprocess_fp) else: raise ApplicationError( "Resuming from checkpoint requires --preprocess option") else: if(preprocess_fp): # we already have preprocessed data, so use it (deprefixed_sff_fp, l, mapping, seqs) = read_preprocessed_data(preprocess_fp) elif(cluster): preprocess_on_cluster(sff_fps, log_fp, fasta_fp=fasta_fp, out_fp=tmpoutdir, verbose=verbose, squeeze=squeeze, primer=primer) (deprefixed_sff_fp, l, mapping, seqs) = read_preprocessed_data(tmpoutdir) else: (deprefixed_sff_fp, l, mapping, seqs) = \ preprocess( sff_fps, log_fh, fasta_fp=fasta_fp, out_fp=tmpoutdir, verbose=verbose, squeeze=squeeze, primer=primer) # preprocessor writes into same file, so better jump to end of file if verbose: log_fh.close() log_fh = open(tmpoutdir + "/" + log_fp, "a", 0) # phase II: # use prefix map based clustering as initial centroids and greedily # add flowgrams to clusters with a low threshold (new_sff_file, bestscores, mapping) = \ greedy_clustering(deprefixed_sff_fp, seqs, mapping, tmpoutdir, l, log_fh, num_cpus=num_cpus, on_cluster=cluster, bail_out=bail, pair_id_thresh=percent_id, threshold=low_cutoff, verbose=verbose, fast_method=not low_memory, error_profile=error_profile, max_num_rounds=max_num_rounds, checkpoint_fp=checkpoint_fp) # phase III phase: # Assign seqs to nearest existing centroid with high threshold secondary_clustering(new_sff_file, mapping, bestscores, log_fh, verbose=verbose, threshold=high_cutoff) remove(new_sff_file) if (verbose): log_fh.write("Finished clustering\n") log_fh.write("Writing Clusters\n") log_fh.write(make_stats(mapping) + "\n") store_clusters(mapping, deprefixed_sff_fp, tmpoutdir) store_mapping(mapping, tmpoutdir, "denoiser")
def denoise_seqs(sff_fps, fasta_fp, tmpoutdir, preprocess_fp=None, cluster=False, num_cpus=1, squeeze=True, percent_id=0.97, bail=1, primer="", low_cutoff=3.75, high_cutoff=4.5, log_fp="denoiser.log", low_memory=False, verbose=False, error_profile=DENOISER_DATA_DIR + 'FLX_error_profile.dat', max_num_rounds=None, titanium=False, checkpoint_fp=None): """The main routine to denoise flowgrams""" # abort if binary is missing check_flowgram_ali_exe() if verbose: # switch of buffering for log file log_fh = open(tmpoutdir + "/" + log_fp, "w", 0) else: log_fh = None # overwrite settings if titanium is set # This flag is only used from qiime. Remove after qiime integration if titanium: error_profile = DENOISER_DATA_DIR + "Titanium_error_profile.dat" low_cutoff = 4 high_cutoff = 5 if verbose: log_fh.write("Denoiser version: %s\n" % __version__) log_fh.write("SFF files: %s\n" % ', '.join(sff_fps)) log_fh.write("Fasta file: %s\n" % fasta_fp) log_fh.write("Preprocess dir: %s\n" % preprocess_fp) if checkpoint_fp: log_fh.write("Resuming denoiser from %s\n" % checkpoint_fp) log_fh.write("Primer sequence: %s\n" % primer) log_fh.write("Running on cluster: %s\n" % cluster) log_fh.write("Num CPUs: %d\n" % num_cpus) log_fh.write("Squeeze Seqs: %s\n" % squeeze) log_fh.write("tmpdir: %s\n" % tmpoutdir) log_fh.write("percent_id threshold: %.2f\n" % percent_id) log_fh.write("Minimal sequence coverage for first phase: %d\n" % bail) log_fh.write("Low cut-off: %.2f\n" % low_cutoff) log_fh.write("High cut-off: %.2f\n" % high_cutoff) log_fh.write("Error profile: %s\n" % error_profile) log_fh.write("Maximal number of iteration: %s\n\n" % max_num_rounds) # here we go ... # Phase I - clean up and truncate input sff if (checkpoint_fp): if (preprocess_fp): # skip preprocessing as we should have data # we already have preprocessed data, so use it (deprefixed_sff_fp, l, mapping, seqs) = read_preprocessed_data(preprocess_fp) else: raise ApplicationError( "Resuming from checkpoint requires --preprocess option") else: if (preprocess_fp): # we already have preprocessed data, so use it (deprefixed_sff_fp, l, mapping, seqs) = read_preprocessed_data(preprocess_fp) elif (cluster): preprocess_on_cluster(sff_fps, log_fp, fasta_fp=fasta_fp, out_fp=tmpoutdir, verbose=verbose, squeeze=squeeze, primer=primer) (deprefixed_sff_fp, l, mapping, seqs) = read_preprocessed_data(tmpoutdir) else: (deprefixed_sff_fp, l, mapping, seqs) = \ preprocess( sff_fps, log_fh, fasta_fp=fasta_fp, out_fp=tmpoutdir, verbose=verbose, squeeze=squeeze, primer=primer) # preprocessor writes into same file, so better jump to end of file if verbose: log_fh.close() log_fh = open(tmpoutdir + "/" + log_fp, "a", 0) # phase II: # use prefix map based clustering as initial centroids and greedily # add flowgrams to clusters with a low threshold (new_sff_file, bestscores, mapping) = \ greedy_clustering(deprefixed_sff_fp, seqs, mapping, tmpoutdir, l, log_fh, num_cpus=num_cpus, on_cluster=cluster, bail_out=bail, pair_id_thresh=percent_id, threshold=low_cutoff, verbose=verbose, fast_method=not low_memory, error_profile=error_profile, max_num_rounds=max_num_rounds, checkpoint_fp=checkpoint_fp) # phase III phase: # Assign seqs to nearest existing centroid with high threshold secondary_clustering(new_sff_file, mapping, bestscores, log_fh, verbose=verbose, threshold=high_cutoff) remove(new_sff_file) if (verbose): log_fh.write("Finished clustering\n") log_fh.write("Writing Clusters\n") log_fh.write(make_stats(mapping) + "\n") store_clusters(mapping, deprefixed_sff_fp, tmpoutdir) store_mapping(mapping, tmpoutdir, "denoiser")