def apostrophePurpose(word): """is the apostrophe being used for gemination, separate 'n' and 'g', etc.""" exp = Base.explode(word) purpose = -1 for i in range(len(exp)): if i > 0 and exp[i] == '\'': if i < len(exp) - 1: if Alphabet.isVowel(exp[i - 1]): if Alphabet.isVowel(exp[i + 1]): purpose = APOS_PREVENT_GEMMINATION break elif exp[i + 1] == 'r': purpose = APOS_DISRUPT_STRESS break else: if Alphabet.isVowel(exp[i + 1]): purpose = APOS_GEMINATION_MARKER break elif exp[i - 1] == 'n' and exp[i + 1] == 'g': purpose = APOS_NG_SEPARATOR break else: # FIXME need to test if a catch-all is appropriate. technically the only # other valid use of a \' is whenever auto-devoicing occurs. (stop + nasal || fric) #FIXME need to do research on autodevoicing to make sure this ^^ is acurate # FIXME will need to write a test to make sure cases without auto devoicing are not matched purpose = APOS_PREVENT_DEVOICING break else: purpose = APOS_SHORT_WORD return purpose
def back_transcribe(self): """Returns the DNA sequence from an RNA sequence. New Seq object. >>> from Bio.Seq import Seq >>> from Bio.Alphabet import IUPAC >>> messenger_rna = Seq("AUGGCCAUUGUAAUGGGCCGCUGAAAGGGUGCCCGAUAG", \ IUPAC.unambiguous_rna) >>> messenger_rna Seq('AUGGCCAUUGUAAUGGGCCGCUGAAAGGGUGCCCGAUAG', IUPACUnambiguousRNA()) >>> messenger_rna.back_transcribe() Seq('ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG', IUPACUnambiguousDNA()) Trying to back-transcribe a protein or DNA sequence raises an exception. >>> my_protein = Seq("MAIVMGR", IUPAC.protein) >>> my_protein.back_transcribe() Traceback (most recent call last): ... ValueError: Proteins cannot be back transcribed! """ if isinstance(Alphabet._get_base_alphabet(self.alphabet), Alphabet.ProteinAlphabet): raise ValueError("Proteins cannot be back transcribed!") if isinstance(Alphabet._get_base_alphabet(self.alphabet), Alphabet.DNAAlphabet): raise ValueError("DNA cannot be back transcribed!") if self.alphabet == IUPAC.unambiguous_rna: alphabet = IUPAC.unambiguous_dna elif self.alphabet == IUPAC.ambiguous_rna: alphabet = IUPAC.ambiguous_dna else: alphabet = Alphabet.generic_dna return Seq(str(self).replace("U", "T").replace("u", "t"), alphabet)
def getSyllables(word): """ return a list of the syllables that make up word """ syllables = [] syl = [] exp = Base.explode(word) for i in range(len(exp)): c = exp[i] syl.append(c) if i < len(exp) - 1: if Alphabet.isConsonant(c) and Alphabet.isConsonant(exp[i + 1]): syllables.append(syl) syl = [] syllables.append(syl) syl = [] syl2 = [] for s in syllables: for i in range(len(s)): if Alphabet.isConsonant(s[i]) and (i > 0 and i < len(s) - 1): if Alphabet.isVowel(s[i - 1]) and Alphabet.isVowel(s[i + 1]): syl2.append(syl) syl = [] syl.append(s[i]) syl2.append(syl) syl = [] return syl2
def getSyllables(word): """ return a list of the syllables that make up word """ syllables = [] syl = [] exp = Base.explode(word) for i in range(len(exp)): c = exp[i] syl.append(c) if i < len(exp) - 1: if Alphabet.isConsonant(c) and Alphabet.isConsonant(exp[i + 1]): syllables.append(syl) syl = [] syllables.append(syl) syl = [] syl2 = [] for s in syllables: for i in range(len(s)): if Alphabet.isConsonant(s[i]) and (i > 0 and i < len(s) - 1): if Alphabet.isVowel(s[i - 1]) and Alphabet.isVowel(s[i + 1]): syl2.append(syl) syl = [] syl.append(s[i]) syl2.append(syl) syl = [] return syl2
def back_transcribe(self): """Returns the DNA sequence from an RNA sequence. New Seq object. >>> from Bio.Seq import Seq >>> from Bio.Alphabet import IUPAC >>> messenger_rna = Seq("AUGGCCAUUGUAAUGGGCCGCUGAAAGGGUGCCCGAUAG", \ IUPAC.unambiguous_rna) >>> messenger_rna Seq('AUGGCCAUUGUAAUGGGCCGCUGAAAGGGUGCCCGAUAG', IUPACUnambiguousRNA()) >>> messenger_rna.back_transcribe() Seq('ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG', IUPACUnambiguousDNA()) Trying to back-transcribe a protein or DNA sequence raises an exception. >>> my_protein = Seq("MAIVMGR", IUPAC.protein) >>> my_protein.back_transcribe() Traceback (most recent call last): ... ValueError: Proteins cannot be back transcribed! """ if isinstance(Alphabet._get_base_alphabet(self.alphabet), Alphabet.ProteinAlphabet) : raise ValueError("Proteins cannot be back transcribed!") if isinstance(Alphabet._get_base_alphabet(self.alphabet), Alphabet.DNAAlphabet) : raise ValueError("DNA cannot be back transcribed!") if self.alphabet==IUPAC.unambiguous_rna: alphabet = IUPAC.unambiguous_dna elif self.alphabet==IUPAC.ambiguous_rna: alphabet = IUPAC.ambiguous_dna else: alphabet = Alphabet.generic_dna return Seq(str(self).replace("U", "T").replace("u", "t"), alphabet)
def run_code(): string = request.form['string'] char = request.form['character'] leng = Alphabet.word_length(string) matching = Alphabet.matching_char(string, char) palin = Alphabet.palindrome_or_not(string) rever = Alphabet.reverse(string) return render_template('pass.html', l=leng, m=matching, p=palin, r=rever)
def test_matching_char(self): sent1 = Alphabet.matching_char("Hi everyone my name is Monish", 'o') self.assertEqual(sent1, 'No. of o in "Hi everyone my name is Monish" is 2') sent2 = Alphabet.matching_char("Hi everyone my name is Oswald", 'O') self.assertEqual(sent2, 'No. of O in "Hi everyone my name is Oswald" is 1')
def setPlayer(self, count): # set player number and get questions according to this. self.count = count self.alphabet = Alphabet(count) self.currentQuestion = self.alphabet.getQuestion() for i in range(0, count): self.faces[i] = Face(i, None) self.faceTrackers[i] = None if(self.faces[i].letter is None): self.faces[i].letter = self.currentQuestion.answer[i]
def __radd__(self, other): if hasattr(other, "alphabet"): #other should be a Seq or a MutableSeq if not Alphabet._check_type_compatible( [self.alphabet, other.alphabet]): raise TypeError("Incompatable alphabets %s and %s" \ % (repr(self.alphabet), repr(other.alphabet))) #They should be the same sequence type (or one of them is generic) a = Alphabet._consensus_alphabet([self.alphabet, other.alphabet]) return self.__class__(str(other) + str(self), a) elif isinstance(other, basestring): #other is a plain string - use the current alphabet return self.__class__(other + str(self), self.alphabet) else: raise TypeError
def __radd__(self, other): if hasattr(other, "alphabet") : #other should be a Seq or a MutableSeq if not Alphabet._check_type_compatible([self.alphabet, other.alphabet]) : raise TypeError("Incompatable alphabets %s and %s" \ % (repr(self.alphabet), repr(other.alphabet))) #They should be the same sequence type (or one of them is generic) a = Alphabet._consensus_alphabet([self.alphabet, other.alphabet]) return self.__class__(str(other) + str(self), a) elif isinstance(other, basestring) : #other is a plain string - use the current alphabet return self.__class__(other + str(self), self.alphabet) else : raise TypeError
def syllableMatches(syl, form): """ eg. syllableMatches('rte', '[V]VCe') capital 'V' or 'C' match vowels and consonants respectively letters in []'s shows optional letters. checks from the end of the word""" # FIXME this is not necessarily done on a syllable by syllable basis. sometimes it # can overlap boundaries sylMatches = False # better handling of 'ng' and other double letters syl = Base.explode(syl) form = Base.explode(form) syl = syl[::-1] form = form[::-1] #FIXME need to write test about if form longer than syl has correct behavior #FIXME optional '[]' letters should not increment i inBrackets = False j = 0 if len(syl) > 0 and len(syl) >= len(form): for i in range(len(form)): if i <= j: if inBrackets: # FIXME not sure if there is really anything to do but ignore if form[i] == '[': inBrackets = False j += 1 else: if form[i] == 'V' and Alphabet.isVowel(syl[j]): sylMatches = True j += 1 elif form[i] == 'C' and Alphabet.isConsonant(syl[j]): sylMatches = True j += 1 elif form[i] == syl[j]: #FIXME this may have some false positives sylMatches = True j += 1 elif form[i] == ']': # we are reversed, so close brackets = open brackets inBrackets = True else: sylMatches = False break else: break return sylMatches
def syllableMatches(syl, form): """ eg. syllableMatches('rte', '[V]VCe') capital 'V' or 'C' match vowels and consonants respectively letters in []'s shows optional letters. checks from the end of the word""" # FIXME this is not necessarily done on a syllable by syllable basis. sometimes it # can overlap boundaries sylMatches = False # better handling of 'ng' and other double letters syl = Base.explode(syl) form = Base.explode(form) syl = syl[::-1] form = form[::-1] #FIXME need to write test about if form longer than syl has correct behavior #FIXME optional '[]' letters should not increment i inBrackets = False j = 0 if len(syl) > 0 and len(syl) >= len(form): for i in range(len(form)): if i <= j: if inBrackets: # FIXME not sure if there is really anything to do but ignore if form[i] == '[': inBrackets = False j += 1 else: if form[i] == 'V' and Alphabet.isVowel(syl[j]): sylMatches = True j += 1 elif form[i] == 'C' and Alphabet.isConsonant(syl[j]): sylMatches = True j += 1 elif form[i] == syl[j]: #FIXME this may have some false positives sylMatches = True j += 1 elif form[i] == ']': # we are reversed, so close brackets = open brackets inBrackets = True else: sylMatches = False break else: break return sylMatches
def explode(word): """ split the word into it's letters. this makes working with letters made up of more than one character (eg. 'll' or 'ng' a whole lot easier """ #FIXME should \' be treated as a separate letter or combined with the letter # it is telling to geminate (eg. r') or completely omited in the output #FIXME needs to throw exception if incorrect character found exploded = [] for i in word: # test if a letter is a valid doubled letter or is 'ng' if len(exploded) > 0 and Alphabet.isADouble(i) and exploded[-1] == i: exploded[-1] = i + i elif len(exploded) > 0 and exploded[-1] == 'n' and i == 'g': exploded[-1] = 'ng' elif len(exploded) > 0 and exploded[-1] == 'ń' and i == 'g': exploded[-1] = 'ńg' elif len(exploded) > 0 and exploded[-1] + i == 'ḿ': exploded[-1] = 'ḿ' elif len(exploded) > 0 and exploded[-1] + i == 'ń': exploded[-1] = 'ń' elif len(exploded) > 0 and (i == '\xe1' or i == '\xb8' or i == '\xbf' or i == '\xc5' or i == '\x84'): if (exploded[-1] == '\xe1' or exploded[-1] == '\xb8' or exploded[-1] == '\xbf' or exploded[-1] == '\xc5' or exploded[-1] == '\x84'): exploded[-1] = exploded[-1] + i else: exploded.append(i) else: exploded.append(i) return exploded
def getAutoGemminationPattern(word): gempat = [] exp = Base.explode(word) rl = getRhythmicVowelLengthPattern(word) for i in range(len(exp)): if i > 0 and i < len(exp) - 2: if Alphabet.isVowel(exp[i - 1]) and Alphabet.isConsonant(exp[i]) and Alphabet.isVowel( exp[i + 1]) and Alphabet.isVowel(exp[i + 2]): gempat.append(True) else: gempat.append(False) elif i > 0 and exp[i - 1] == 'e' and hasRhythmicLength(word, i - 1): gempat.append(True) else: gempat.append(False) return gempat
def __cmp__(self, other): """Compare the sequence for to another sequence or a string. If compared to another sequence the alphabets must be compatible. Comparing DNA to RNA, or Nucleotide to Protein will raise an exception. Otherwise only the sequence itself is compared, not the precise alphabet. This method indirectly supports ==, < , etc.""" if hasattr(other, "alphabet") : #other should be a Seq or a MutableSeq if not Alphabet._check_type_compatible([self.alphabet, other.alphabet]) : raise TypeError("Incompatable alphabets %s and %s" \ % (repr(self.alphabet), repr(other.alphabet))) #They should be the same sequence type (or one of them is generic) if isinstance(other, MutableSeq): #See test_GAQueens.py for an historic usage of a non-string #alphabet! Comparing the arrays supports this. return cmp(self.data, other.data) else : return cmp(str(self), str(other)) elif isinstance(other, basestring) : return cmp(str(self), other) else : raise TypeError
def __cmp__(self, other): """Compare the sequence for to another sequence or a string. If compared to another sequence the alphabets must be compatible. Comparing DNA to RNA, or Nucleotide to Protein will raise an exception. Otherwise only the sequence itself is compared, not the precise alphabet. This method indirectly supports ==, < , etc.""" if hasattr(other, "alphabet"): #other should be a Seq or a MutableSeq if not Alphabet._check_type_compatible( [self.alphabet, other.alphabet]): raise TypeError("Incompatable alphabets %s and %s" \ % (repr(self.alphabet), repr(other.alphabet))) #They should be the same sequence type (or one of them is generic) if isinstance(other, MutableSeq): #See test_GAQueens.py for an historic usage of a non-string #alphabet! Comparing the arrays supports this. return cmp(self.data, other.data) else: return cmp(str(self), str(other)) elif isinstance(other, basestring): return cmp(str(self), other) else: raise TypeError
def explode(word): """ split the word into it's letters. this makes working with letters made up of more than one character (eg. 'll' or 'ng' a whole lot easier """ #FIXME should \' be treated as a separate letter or combined with the letter # it is telling to geminate (eg. r') or completely omited in the output #FIXME needs to throw exception if incorrect character found exploded = [] for i in word: # test if a letter is a valid doubled letter or is 'ng' if len(exploded) > 0 and Alphabet.isADouble(i) and exploded[-1] == i: exploded[-1] = i + i elif len(exploded) > 0 and exploded[-1] == 'n' and i == 'g': exploded[-1] = 'ng' elif len(exploded) > 0 and exploded[-1] == 'ń' and i == 'g': exploded[-1] = 'ńg' elif len(exploded) > 0 and exploded[-1] + i == 'ḿ': exploded[-1] = 'ḿ' elif len(exploded) > 0 and exploded[-1] + i == 'ń': exploded[-1] = 'ń' elif len(exploded) > 0 and (i == '\xe1' or i == '\xb8' or i == '\xbf' or i == '\xc5' or i == '\x84'): if (exploded[-1] == '\xe1' or exploded[-1] == '\xb8' or exploded[-1] == '\xbf' or exploded[-1] == '\xc5' or exploded[-1] == '\x84'): exploded[-1] = exploded[-1] + i else: exploded.append(i) else: exploded.append(i) return exploded
def genBtn(root, x_inc): btn_x_coord = 0 btn_list = [] for char in alpha.getUpper(): btn = makeBtn(root, char, 2, 5) btn.place(x=btn_x_coord, y=10) btn_list.append(btn) btn_x_coord += x_inc return btn_list
def __radd__(self, other): if hasattr(other, "alphabet"): #other should be a Seq or a MutableSeq if not Alphabet._check_type_compatible( [self.alphabet, other.alphabet]): raise TypeError("Incompatable alphabets %s and %s" \ % (repr(self.alphabet), repr(other.alphabet))) #They should be the same sequence type (or one of them is generic) a = Alphabet._consensus_alphabet([self.alphabet, other.alphabet]) if isinstance(other, MutableSeq): #See test_GAQueens.py for an historic usage of a non-string #alphabet! Adding the arrays should support this. return self.__class__(other.data + self.data, a) else: return self.__class__(str(other) + str(self), a) elif isinstance(other, basestring): #other is a plain string - use the current alphabet return self.__class__(str(other) + str(self), self.alphabet) else: raise TypeError
def __radd__(self, other): if hasattr(other, "alphabet") : #other should be a Seq or a MutableSeq if not Alphabet._check_type_compatible([self.alphabet, other.alphabet]) : raise TypeError("Incompatable alphabets %s and %s" \ % (repr(self.alphabet), repr(other.alphabet))) #They should be the same sequence type (or one of them is generic) a = Alphabet._consensus_alphabet([self.alphabet, other.alphabet]) if isinstance(other, MutableSeq): #See test_GAQueens.py for an historic usage of a non-string #alphabet! Adding the arrays should support this. return self.__class__(other.data + self.data, a) else : return self.__class__(str(other) + str(self), a) elif isinstance(other, basestring) : #other is a plain string - use the current alphabet return self.__class__(str(other) + str(self), self.alphabet) else : raise TypeError
def complement(self): """Returns the complement sequence. New Seq object. >>> from Bio.Seq import Seq >>> from Bio.Alphabet import IUPAC >>> my_dna = Seq("CCCCCGATAG", IUPAC.unambiguous_dna) >>> my_dna Seq('CCCCCGATAG', IUPACUnambiguousDNA()) >>> my_dna.complement() Seq('GGGGGCTATC', IUPACUnambiguousDNA()) Trying to complement a protein sequence raises an exception. >>> my_protein = Seq("MAIVMGR", IUPAC.protein) >>> my_protein.complement() Traceback (most recent call last): ... ValueError: Proteins do not have complements! """ if isinstance(Alphabet._get_base_alphabet(self.alphabet), Alphabet.ProteinAlphabet) : raise ValueError("Proteins do not have complements!") if isinstance(Alphabet._get_base_alphabet(self.alphabet), Alphabet.DNAAlphabet) : d = ambiguous_dna_complement elif isinstance(Alphabet._get_base_alphabet(self.alphabet), Alphabet.RNAAlphabet) : d = ambiguous_rna_complement elif 'U' in self._data and 'T' in self._data: #TODO - Handle this cleanly? raise ValueError("Mixed RNA/DNA found") elif 'U' in self._data: d = ambiguous_rna_complement else: d = ambiguous_dna_complement ttable = self.__maketrans(d) #Much faster on really long sequences than the previous loop based one. #thx to Michael Palmer, University of Waterloo s = str(self).translate(ttable) return Seq(s, self.alphabet)
def complement(self): """Returns the complement sequence. New Seq object. >>> from Bio.Seq import Seq >>> from Bio.Alphabet import IUPAC >>> my_dna = Seq("CCCCCGATAG", IUPAC.unambiguous_dna) >>> my_dna Seq('CCCCCGATAG', IUPACUnambiguousDNA()) >>> my_dna.complement() Seq('GGGGGCTATC', IUPACUnambiguousDNA()) Trying to complement a protein sequence raises an exception. >>> my_protein = Seq("MAIVMGR", IUPAC.protein) >>> my_protein.complement() Traceback (most recent call last): ... ValueError: Proteins do not have complements! """ if isinstance(Alphabet._get_base_alphabet(self.alphabet), Alphabet.ProteinAlphabet): raise ValueError("Proteins do not have complements!") if isinstance(Alphabet._get_base_alphabet(self.alphabet), Alphabet.DNAAlphabet): d = ambiguous_dna_complement elif isinstance(Alphabet._get_base_alphabet(self.alphabet), Alphabet.RNAAlphabet): d = ambiguous_rna_complement elif 'U' in self._data and 'T' in self._data: #TODO - Handle this cleanly? raise ValueError("Mixed RNA/DNA found") elif 'U' in self._data: d = ambiguous_rna_complement else: d = ambiguous_dna_complement ttable = self.__maketrans(d) #Much faster on really long sequences than the previous loop based one. #thx to Michael Palmer, University of Waterloo s = str(self).translate(ttable) return Seq(s, self.alphabet)
def lSyllableMatches(syl, form): """ eg. syllableMatches('rte', '[V]VCe') capital 'V' or 'C' match vowels and consonants respectivly letters in []'s shows optional letters. checks from the start of the word""" # FIXME this is not necessarily done on a syllable by syllable basis. sometimes it # can overlap boundaries sylMatches = False # better handling of 'ng' and other double letters syl = Base.explode(syl) form = Base.explode(form) if len(syl) > 0: inBrackets = False j = 0 for i in range(len(form)): if inBrackets: # FIXME not sure if there is really anything to do but ignore if form[i] == '[': inBrackets = False j += 1 else: if form[i] == 'V' and Alphabet.isVowel(syl[j]): sylMatches = True j += 1 elif form[i] == 'C' and Alphabet.isConsonant(syl[j]): sylMatches = True j += 1 elif form[i] == syl[j]: #FIXME this may have some false positives sylMatches = True j += 1 elif form[i] == ']': # we are reversed, so close brackets = open brackets inBrackets = True else: sylMatches = False break return sylMatches
def lSyllableMatches(syl, form): """ eg. syllableMatches('rte', '[V]VCe') capital 'V' or 'C' match vowels and consonants respectivly letters in []'s shows optional letters. checks from the start of the word""" # FIXME this is not necessarily done on a syllable by syllable basis. sometimes it # can overlap boundaries sylMatches = False # better handling of 'ng' and other double letters syl = Base.explode(syl) form = Base.explode(form) if len(syl) > 0: inBrackets = False j = 0 for i in range(len(form)): if inBrackets: # FIXME not sure if there is really anything to do but ignore if form[i] == '[': inBrackets = False j += 1 else: if form[i] == 'V' and Alphabet.isVowel(syl[j]): sylMatches = True j += 1 elif form[i] == 'C' and Alphabet.isConsonant(syl[j]): sylMatches = True j += 1 elif form[i] == syl[j]: #FIXME this may have some false positives sylMatches = True j += 1 elif form[i] == ']': # we are reversed, so close brackets = open brackets inBrackets = True else: sylMatches = False break return sylMatches
def getBtns(): x_coord = 10 iteration = 0 btn_lst = [] for itr, char in enumerate(alpha.getUpper()): if itr < 13: btn = Button(0, 255, 0, x_coord, 10, 40, 40, char) btn_lst.append(btn) x_coord += 70 if itr > 12: if iteration == 0: x_coord = 10 iteration = 1 btn = Button(0, 255, 0, x_coord, 80, 40, 40, char) btn_lst.append(btn) x_coord += 70 return btn_lst # return lbl_list
def isVoiced(word, c): """test position c to see if it is voiced""" # FIXME does not properly handle if char other than a stop or fricative is found at 'c' voiced = True exp = Base.explode(word) l = exp[c] if c == 0 and l == 's': voiced = False elif c == len(exp) - 1 and l == 'r': voiced = False elif Alphabet.isVoicelessFricative(l): voiced = False elif Alphabet.isVoicelessNasal(l): voiced = False elif Alphabet.isVoicedFricative(l): if c > 0 and (Alphabet.isVoicelessFricative(exp[c - 1]) or Alphabet.isStop(exp[c - 1])): voiced = False elif c < len(exp) - 1 and Alphabet.isStop(exp[c + 1]): voiced = False elif Alphabet.isVoicedNasal(l) and c > 0 and ( Alphabet.isVoicelessFricative(exp[c - 1]) or Alphabet.isStop(exp[c - 1])): voiced = False return voiced
def _get_seq_str_and_check_alphabet(self, other_sequence) : """string/Seq/MutableSeq to string, checking alphabet (PRIVATE). For a string argument, returns the string. For a Seq or MutableSeq, it checks the alphabet is compatible (raising an exception if it isn't), and then returns a string. """ try : other_alpha = other_sequence.alphabet except AttributeError : #Assume other_sequence is a string return other_sequence #Other should be a Seq or a MutableSeq if not Alphabet._check_type_compatible([self.alphabet, other_alpha]) : raise TypeError("Incompatable alphabets %s and %s" \ % (repr(self.alphabet), repr(other_alpha))) #Return as a string return str(other_sequence)
def _get_seq_str_and_check_alphabet(self, other_sequence): """string/Seq/MutableSeq to string, checking alphabet (PRIVATE). For a string argument, returns the string. For a Seq or MutableSeq, it checks the alphabet is compatible (raising an exception if it isn't), and then returns a string. """ try: other_alpha = other_sequence.alphabet except AttributeError: #Assume other_sequence is a string return other_sequence #Other should be a Seq or a MutableSeq if not Alphabet._check_type_compatible([self.alphabet, other_alpha]): raise TypeError("Incompatable alphabets %s and %s" \ % (repr(self.alphabet), repr(other_alpha))) #Return as a string return str(other_sequence)
def initialize(): global btn_list program = App(root) # App.draw_hangman() panel = Label(root, height=350, width=450, image=img_list[0]) panel.place(x=425, y=60) #create all buttons :) btn_x_coord = 0 btn_list = [] for char in alpha.getLower(): btn = App.make_btn(program, char, 2, 5) btn.pack() btn.place(x=btn_x_coord, y=10) btn_list.append(btn) btn_x_coord += 50 #Set location and size of window and initialize it root.geometry('1295x500+10+10') root.mainloop()
def complement(self): """Modify the mutable sequence to take on its complement. Trying to complement a protein sequence raises an exception. No return value""" if isinstance(Alphabet._get_base_alphabet(self.alphabet), Alphabet.ProteinAlphabet) : raise ValueError("Proteins do not have complements!") if self.alphabet in (IUPAC.ambiguous_dna, IUPAC.unambiguous_dna): d = ambiguous_dna_complement elif self.alphabet in (IUPAC.ambiguous_rna, IUPAC.unambiguous_rna): d = ambiguous_rna_complement elif 'U' in self.data and 'T' in self.data : #TODO - Handle this cleanly? raise ValueError("Mixed RNA/DNA found") elif 'U' in self.data: d = ambiguous_rna_complement else: d = ambiguous_dna_complement c = dict([(x.lower(), y.lower()) for x,y in d.iteritems()]) d.update(c) self.data = map(lambda c: d[c], self.data) self.data = array.array('c', self.data)
def complement(self): """Modify the mutable sequence to take on its complement. Trying to complement a protein sequence raises an exception. No return value""" if isinstance(Alphabet._get_base_alphabet(self.alphabet), Alphabet.ProteinAlphabet): raise ValueError("Proteins do not have complements!") if self.alphabet in (IUPAC.ambiguous_dna, IUPAC.unambiguous_dna): d = ambiguous_dna_complement elif self.alphabet in (IUPAC.ambiguous_rna, IUPAC.unambiguous_rna): d = ambiguous_rna_complement elif 'U' in self.data and 'T' in self.data: #TODO - Handle this cleanly? raise ValueError("Mixed RNA/DNA found") elif 'U' in self.data: d = ambiguous_rna_complement else: d = ambiguous_dna_complement c = dict([(x.lower(), y.lower()) for x, y in d.iteritems()]) d.update(c) self.data = map(lambda c: d[c], self.data) self.data = array.array('c', self.data)
def isClassIVa(base): """ word ends in a fricitive followed by 'te' """ exp = explode(base) isClass = len(exp) > 2 and isClassIV(base) and Alphabet.isFricative( exp[-3]) return isClass
import alphabetByDiana if __name__ == "__main__": print("Alphabet task has started :)") start = input("Enter a start string: ") # aaa finish = input("Enter where to finish: ") # aba print("First solution") printIterationOverStringsAlphabetically(start, finish) print("Second Solution") AlphabetGit.printAlphabet(start, finish) print("3rd Solution") print_char_combinations(start, finish) print("4th Solution") Alphabet.printAlphabet(start, finish) print("5th Solution") abcByDanilov.alp_start(start, finish) print("6th Solution") alphabet_Bochkareva.abc(start, finish) print("7th Solution") TaskChizh.IterateStrings(start, finish) print("8th Solution") alphabetByDiana.checkAssepted(start, finish)
def isClassIVb(base): """ words that end with a vowel followed by 'te' """ exp = explode(base) isClass = len(exp) > 2 and isClassIV(base) and Alphabet.isVowel(exp[-3]) return isClass
class Game: # Logic class of all project. It uses all other classes. Main.py call it dor rendering by each frame faces = {} faceTrackers = {} count = 3 alphabet = None currentQuestion = None LEVEL = 1 time = 60 # secs per minute resultImage = None ORDER_FLAG = False def __init__(self): self.faceCascade = cv2.CascadeClassifier("./assets/haarcascade_frontalface_default.xml") cv2.startWindowThread() self.currentImage = 0 # the first image is selected self.currentImageID = 0 self.rectangleColor = (0, 165, 255) self.frameCounter = 0 self.currentFaceID = 0 self.setPlayer(self.count) def setCapture(self, cap): # set camera capture for initilization # Open the first webcame device self.capture = cap self.frameWidth = int(self.capture.get(3)) # float self.frameHeight = int(self.capture.get(4)) # float def setPlayer(self, count): # set player number and get questions according to this. self.count = count self.alphabet = Alphabet(count) self.currentQuestion = self.alphabet.getQuestion() for i in range(0, count): self.faces[i] = Face(i, None) self.faceTrackers[i] = None if(self.faces[i].letter is None): self.faces[i].letter = self.currentQuestion.answer[i] def render(self): # rendering function of game. Main.py calls it each frame # Retrieve the latest image from the webcam rc, baseImage = self.capture.read() baseImage = cv2.flip(baseImage, 1) # mirror effect # Copy base image self.resultImage = baseImage.copy() # Increase the framecounter self.frameCounter += 1 # Update all the trackers and remove the ones for which the update # indicated the quality was not good enough fidsToDelete = [] for i in range(self.count): if(self.faces[i].tracker is not None): trackingQuality = self.faces[i].update(baseImage) # If the tracking quality is good enough, we must delete # this tracker if trackingQuality < 7: self.faces[i].tracker = None # Every 10 frames, we will have to determine which faces # are present in the frame if (self.frameCounter % 10) == 0: # For the face detection, we need to make use of a gray # colored image so we will convert the baseImage to a # gray-based image gray = cv2.cvtColor(baseImage, cv2.COLOR_BGR2GRAY) # Now use the haar cascade detector to find all faces # in the image localFaces = self.faceCascade.detectMultiScale(gray, 1.3, 5) # Loop over all faces and check if the area for this # face is the largest so far # We need to convert it to int here because of the # requirement of the dlib tracker. If we omit the cast to # int here, you will get cast errors since the detector # returns numpy.int32 and the tracker requires an int for (_x, _y, _w, _h) in localFaces: x = int(_x) y = int(_y) w = int(_w) h = int(_h) # calculate the centerpoint x_bar = x + 0.5 * w y_bar = y + 0.5 * h # Variable holding information which faceid we # matched with matchedFid = None # Now loop over all the trackers and check if the # centerpoint of the face is within the box of a # tracker for i in range(self.count): if(self.faces[i].tracker is not None): self.faces[i].update(baseImage) pos = self.faces[i].tracker.get_position() t_x = int(pos.left()) t_y = int(pos.top()) t_w = int(pos.width()) t_h = int(pos.height()) # calculate the centerpoint t_x_bar = t_x + 0.5 * t_w t_y_bar = t_y + 0.5 * t_h # check if the centerpoint of the face is within the # rectangleof a tracker region. Also, the centerpoint # of the tracker region must be within the region # detected as a face. If both of these conditions hold # we have a match if ((t_x <= x_bar <= (t_x + t_w)) and (t_y <= y_bar <= (t_y + t_h)) and (x <= t_x_bar <= (x + w)) and (y <= t_y_bar <= (y + h))): matchedFid = True # If no matched fid, then we have to create a new tracker if matchedFid is None: # Create and store the tracker tracker = dlib.correlation_tracker() tracker.start_track(baseImage, dlib.rectangle(x, y, x+w, y+h)) pos = tracker.get_position() t_x = int(pos.left()) t_y = int(pos.top()) t_w = int(pos.width()) t_h = int(pos.height()) for i in range(self.count): if(self.faces[i].tracker is None): if(self.faces[i].encoding is None): if(self.faces[i].save(baseImage[t_y:t_y+t_h, t_x:t_x+t_w]) is True): self.faces[i].tracker = tracker self.faces[i].update(baseImage) break else: crop = baseImage[t_y:t_y + t_h, t_x:t_x+t_w] if(self.faces[i].checkFace(crop) is True): self.faces[i].tracker = tracker self.faces[i].update(baseImage) break # Increase the currentFaceID counter self.currentFaceID += 1 for i in range(self.count): if(self.faces[i].tracker is not None): t_x = int(self.faces[i].x) t_y = int(self.faces[i].y) t_w = int(self.faces[i].w) t_h = int(self.faces[i].h) replaceImg = read_transparent_png(self.faces[i].letter) rows, cols, ch = replaceImg.shape # this points are necesary for the transformation pts1 = np.float32( [[0, 0], [cols, 0], [cols, rows], [0, rows]]) self.currentImage += 1 # pts2 is used for defining the perspective transform pts2 = np.float32([[t_x, (DISTANCE_OF_LETTER*t_y)], [(t_x+t_w), (DISTANCE_OF_LETTER*t_y)], [(t_x+t_w), ((DISTANCE_OF_LETTER*t_y)+t_h)], [t_x, ((DISTANCE_OF_LETTER*t_y)+t_h)]]) # compute the transform matrix M = cv2.getPerspectiveTransform(pts1, pts2) rows, cols, ch = self.resultImage.shape # make the perspective change in a image of the size of the camera input dst = cv2.warpPerspective(replaceImg, M, (cols, rows)) # A mask is created for adding the two images # maskThreshold is a variable because that allows to substract the black background from different images ret, mask = cv2.threshold(cv2.cvtColor( dst, cv2.COLOR_BGR2GRAY), MASK_TRESHOLD, 1, cv2.THRESH_BINARY_INV) # Erode and dilate are used to delete the noise mask = cv2.erode(mask, (3, 3)) mask = cv2.dilate(mask, (3, 3)) # The two images are added using the mask for c in range(0, 3): self.resultImage[:, :, c] = dst[:, :, c] * \ (1-mask[:, :]) + self.resultImage[:, :, c]*mask[:, :] cv2.rectangle(self.resultImage, (t_x, t_y), (t_x + t_w, t_y + t_h), self.rectangleColor, 2) # draw question self.resultImage = self.drawQuestion(self.currentQuestion.question, self.frameHeight, self.frameWidth) if(self.isOrderTrue() is True): self.ORDER_FLAG = True print("ORDER IS TRUE") self.nextQuestion() return self.resultImage def dispose(self): # dispose all datas when game closed or finished game # Destroy any OpenCV windows and exit the application self.capture.release() cv2.CAP_MSMF = 0 cv2.destroyAllWindows() def isOrderTrue(self): # checker for right order order = True lst = [] for i in range(self.count): lst.append(self.faces[i].letter) lst.sort(key=lambda x: x.id, reverse=False) for i in range(self.count-1): x1 = lst[i].x x2 = lst[i+1].x if(x1 >= x2): # if before x is bigger return false, otherwise true order = False break return order def nextQuestion(self): # get next wuestion from Alphabet class self.LEVEL += 1 self.currentQuestion = self.alphabet.getQuestion() for i in range(0, self.count): self.faces[i] = Face(-1, None) self.faceTrackers[i] = None if(self.faces[i].letter is None): self.faces[i].letter = self.currentQuestion.answer[i] def drawQuestion(self, word, fHeight, fWidth): # draw question using OpenCV fontpath = "./assets/TTWPGOTT.ttf" (r, g, b, a) = (125, 222, 205, 1) line = word ft = ImageFont.truetype(fontpath, 20) img_pil = Image.fromarray(self.resultImage) draw = ImageDraw.Draw(img_pil) if(len(line) > 60): draw.rectangle( [(40, fHeight - 45), (fWidth-40, fHeight-5)], (61, 0, 59, 1)) line1 = line[0:60] line2 = line[60:len(line)] draw.text((50, fHeight - 45), line1, font=ft, fill=(r, g, b, a)) draw.text((50, fHeight - 25), line2, font=ft, fill=(r, g, b, a)) else: draw.rectangle( [(40, fHeight - 45), (fWidth-40, fHeight-5)], (61, 0, 59, 1)) draw.text((50, fHeight - 30), line, font=ft, fill=(r, g, b, a)) # level draw.text((fWidth - 50, 5), str("LEVEL"), font=ft, fill=(61, 0, 59, 1)) draw.ellipse([(fWidth - 50, 25), (fWidth-10, 65)], (61, 0, 59, 1)) draw.text((fWidth - 40, 35), str("{:02d}".format(self.LEVEL)), font=ft, fill=(r, g, b, a)) # time draw.text((15, 5), str("SÜRE"), font=ft, fill=(61, 0, 59, 1)) draw.ellipse([(10, 25), (50, 65)], (61, 0, 59, 1)) draw.text((20, 35), str("{:02d}".format(self.time)), font=ft, fill=(r, g, b, a)) return np.array(img_pil)
import Alphabet Alphabet.GenerateVigenereTable()
def translate(self, table="Standard", stop_symbol="*", to_stop=False): """Turns a nucleotide sequence into a protein sequence. New Seq object. Trying to back-transcribe a protein sequence raises an exception. This method will translate DNA or RNA sequences. Trying to translate a protein sequence raises an exception. table - Which codon table to use? This can be either a name (string) or an NCBI identifier (integer). This defaults to the "Standard" table. stop_symbol - Single character string, what to use for terminators. This defaults to the asterisk, "*". to_stop - Boolean, defaults to False meaning do a full translation continuing on past any stop codons (translated as the specified stop_symbol). If True, translation is terminated at the first in frame stop codon (and the stop_symbol is not appended to the returned protein sequence). e.g. Using the standard table, >>> coding_dna = Seq("GTGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG") >>> coding_dna.translate() Seq('VAIVMGR*KGAR*', HasStopCodon(ExtendedIUPACProtein(), '*')) >>> coding_dna.translate(stop_symbol="@") Seq('VAIVMGR@KGAR@', HasStopCodon(ExtendedIUPACProtein(), '@')) >>> coding_dna.translate(to_stop=True) Seq('VAIVMGR', ExtendedIUPACProtein()) Now using NCBI table 2, where TGA is not a stop codon: >>> coding_dna.translate(table=2) Seq('VAIVMGRWKGAR*', HasStopCodon(ExtendedIUPACProtein(), '*')) >>> coding_dna.translate(table=2, to_stop=True) Seq('VAIVMGRWKGAR', ExtendedIUPACProtein()) If the sequence has no in-frame stop codon, then the to_stop argument has no effect: >>> coding_dna2 = Seq("TTGGCCATTGTAATGGGCCGC") >>> coding_dna2.translate() Seq('LAIVMGR', ExtendedIUPACProtein()) >>> coding_dna2.translate(to_stop=True) Seq('LAIVMGR', ExtendedIUPACProtein()) NOTE - Ambiguous codons like "TAN" or "NNN" could be an amino acid or a stop codon. These are translated as "X". Any invalid codon (e.g. "TA?" or "T-A") will throw a TranslationError. NOTE - Does NOT support gapped sequences. NOTE - This does NOT behave like the python string's translate method. For that use str(my_seq).translate(...) instead. """ try: table_id = int(table) except ValueError: table_id = None if isinstance(table, str) and len(table)==256 : raise ValueError("The Seq object translate method DOES NOT take " \ + "a 256 character string mapping table like " \ + "the python string object's translate method. " \ + "Use str(my_seq).translate(...) instead.") if isinstance(Alphabet._get_base_alphabet(self.alphabet), Alphabet.ProteinAlphabet) : raise ValueError("Proteins cannot be translated!") if self.alphabet==IUPAC.unambiguous_dna: if table_id is None: codon_table = CodonTable.unambiguous_dna_by_name[table] else: codon_table = CodonTable.unambiguous_dna_by_id[table_id] elif self.alphabet==IUPAC.ambiguous_dna: if table_id is None: codon_table = CodonTable.ambiguous_dna_by_name[table] else: codon_table = CodonTable.ambiguous_dna_by_id[table_id] elif self.alphabet==IUPAC.unambiguous_rna: if table_id is None: codon_table = CodonTable.unambiguous_rna_by_name[table] else: codon_table = CodonTable.unambiguous_rna_by_id[table_id] elif self.alphabet==IUPAC.ambiguous_rna: if table_id is None: codon_table = CodonTable.ambiguous_rna_by_name[table] else: codon_table = CodonTable.ambiguous_rna_by_id[table_id] else: if table_id is None: codon_table = CodonTable.ambiguous_generic_by_name[table] else: codon_table = CodonTable.ambiguous_generic_by_id[table_id] protein = _translate_str(str(self), codon_table, stop_symbol, to_stop) if stop_symbol in protein : alphabet = Alphabet.HasStopCodon(codon_table.protein_alphabet, stop_symbol = stop_symbol) else : alphabet = codon_table.protein_alphabet return Seq(protein, alphabet)
def isClassII(base): """ word ends in 2 prime vowels """ exp = explode(base) isClass = len(exp) > 1 and Alphabet.isPrimeVowel( exp[-1]) and Alphabet.isPrimeVowel(exp[-2]) return isClass
def translate(self, table="Standard", stop_symbol="*", to_stop=False): """Turns a nucleotide sequence into a protein sequence. New Seq object. Trying to back-transcribe a protein sequence raises an exception. This method will translate DNA or RNA sequences. Trying to translate a protein sequence raises an exception. table - Which codon table to use? This can be either a name (string) or an NCBI identifier (integer). This defaults to the "Standard" table. stop_symbol - Single character string, what to use for terminators. This defaults to the asterisk, "*". to_stop - Boolean, defaults to False meaning do a full translation continuing on past any stop codons (translated as the specified stop_symbol). If True, translation is terminated at the first in frame stop codon (and the stop_symbol is not appended to the returned protein sequence). e.g. Using the standard table, >>> coding_dna = Seq("GTGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG") >>> coding_dna.translate() Seq('VAIVMGR*KGAR*', HasStopCodon(ExtendedIUPACProtein(), '*')) >>> coding_dna.translate(stop_symbol="@") Seq('VAIVMGR@KGAR@', HasStopCodon(ExtendedIUPACProtein(), '@')) >>> coding_dna.translate(to_stop=True) Seq('VAIVMGR', ExtendedIUPACProtein()) Now using NCBI table 2, where TGA is not a stop codon: >>> coding_dna.translate(table=2) Seq('VAIVMGRWKGAR*', HasStopCodon(ExtendedIUPACProtein(), '*')) >>> coding_dna.translate(table=2, to_stop=True) Seq('VAIVMGRWKGAR', ExtendedIUPACProtein()) If the sequence has no in-frame stop codon, then the to_stop argument has no effect: >>> coding_dna2 = Seq("TTGGCCATTGTAATGGGCCGC") >>> coding_dna2.translate() Seq('LAIVMGR', ExtendedIUPACProtein()) >>> coding_dna2.translate(to_stop=True) Seq('LAIVMGR', ExtendedIUPACProtein()) NOTE - Ambiguous codons like "TAN" or "NNN" could be an amino acid or a stop codon. These are translated as "X". Any invalid codon (e.g. "TA?" or "T-A") will throw a TranslationError. NOTE - Does NOT support gapped sequences. NOTE - This does NOT behave like the python string's translate method. For that use str(my_seq).translate(...) instead. """ try: table_id = int(table) except ValueError: table_id = None if isinstance(table, str) and len(table) == 256: raise ValueError("The Seq object translate method DOES NOT take " \ + "a 256 character string mapping table like " \ + "the python string object's translate method. " \ + "Use str(my_seq).translate(...) instead.") if isinstance(Alphabet._get_base_alphabet(self.alphabet), Alphabet.ProteinAlphabet): raise ValueError("Proteins cannot be translated!") if self.alphabet == IUPAC.unambiguous_dna: if table_id is None: codon_table = CodonTable.unambiguous_dna_by_name[table] else: codon_table = CodonTable.unambiguous_dna_by_id[table_id] elif self.alphabet == IUPAC.ambiguous_dna: if table_id is None: codon_table = CodonTable.ambiguous_dna_by_name[table] else: codon_table = CodonTable.ambiguous_dna_by_id[table_id] elif self.alphabet == IUPAC.unambiguous_rna: if table_id is None: codon_table = CodonTable.unambiguous_rna_by_name[table] else: codon_table = CodonTable.unambiguous_rna_by_id[table_id] elif self.alphabet == IUPAC.ambiguous_rna: if table_id is None: codon_table = CodonTable.ambiguous_rna_by_name[table] else: codon_table = CodonTable.ambiguous_rna_by_id[table_id] else: if table_id is None: codon_table = CodonTable.ambiguous_generic_by_name[table] else: codon_table = CodonTable.ambiguous_generic_by_id[table_id] protein = _translate_str(str(self), codon_table, stop_symbol, to_stop) if stop_symbol in protein: alphabet = Alphabet.HasStopCodon(codon_table.protein_alphabet, stop_symbol=stop_symbol) else: alphabet = codon_table.protein_alphabet return Seq(protein, alphabet)
def isClassII(base): """ word ends in 2 prime vowels """ exp = explode(base) isClass = len(exp) > 1 and Alphabet.isPrimeVowel(exp[-1]) and Alphabet.isPrimeVowel(exp[-2]) return isClass
def isClassVI(base): """ all words ending in a consonant and that are not Class V """ exp = explode(base) isClass = len(exp) > 1 and Alphabet.isConsonant(exp[-1]) and not isClassV(base) return isClass
def isClassIVa(base): """ word ends in a fricitive followed by 'te' """ exp = explode(base) isClass = len(exp) > 2 and isClassIV(base) and Alphabet.isFricative(exp[-3]) return isClass
def isClassIVb(base): """ words that end with a vowel followed by 'te' """ exp = explode(base) isClass = len(exp) > 2 and isClassIV(base) and Alphabet.isVowel(exp[-3]) return isClass
def test_reverse(self): rever = Alphabet.reverse('Hello Everyone') self.assertEqual(rever, 'The reverse of String: enoyrevE olleH')
def test_word_length(self): self.assertEqual(Alphabet.word_length("Welcome to TCS"), 'The number of characters in "Welcome to TCS" is 12') self.assertEqual(Alphabet.word_length(""), 'The number of characters in "" is 0')
def test_palindrome_or_not(self): palinsent1 = Alphabet.palindrome_or_not('Hello Everyone') self.assertEqual(palinsent1, "Its Not a Palindrome") palinsent2 = Alphabet.palindrome_or_not('Race car') self.assertEqual(palinsent2, "Its a Palindrome")