def main(assembly, filename): a = Assembly(assembly) tmap = a.get_transcript_mapping() # Get total num of reads f = open(filename) g = open('simulation/count_simulation.txt','wb') header = ['ID','Count','RPKM','Chrom','Start','End','Strand','GeneName','Length','Type','Sense','Synonyms'] g.write('\t'.join(header)+'\n') for line in f: loc, tid, coding, length, \ expr_fraction, expr_number, lib_fraction, lib_number, seq_fraction, seq_number, \ cov_fraction, chisq, var_coeff = line.split('\t') chrom,coord = loc.split(':') start,end = coord[:-1].split('-') strand = '1' if coord[-1] == 'W' else '-1' nreads = float(seq_number) if nreads != 0: ntotal = nreads / float(seq_fraction) rpkm = 1e9 * nreads / (float(length) * ntotal) else: rpkm = 0.0 t = tmap.get(tid) if t is not None: newline = [tid, seq_number, str(rpkm), chrom,start,end,strand, t.gene_name,length,'transcript','.','.'] g.write('\t'.join(newline)+'\n') f.close() g.close()
def setUp(self): self.assembly = Assembly('ce6') self.assembly.genrep = GenRep(url='http://bbcftools.epfl.ch/genrep/', root='/db/genrep') self.assembly.intype = '0' self.chromosomes = { (3066, u'NC_003279', 6): { 'length': 15072421, 'name': u'chrI' }, (3067, u'NC_003280', 7): { 'length': 15279323, 'name': u'chrII' }, (3068, u'NC_003281', 8): { 'length': 13783681, 'name': u'chrIII' }, (3069, u'NC_003282', 5): { 'length': 17493785, 'name': u'chrIV' }, (3070, u'NC_003283', 8): { 'length': 20919568, 'name': u'chrV' }, (3071, u'NC_003284', 7): { 'length': 17718854, 'name': u'chrX' }, (2948, u'NC_001328', 1): { 'length': 13794, 'name': u'chrM' } }
def main(assembly, filename): a = Assembly(assembly) tmap = a.get_transcript_mapping() # Get total num of reads f = open(filename) g = open('simulation/count_simulation.txt', 'wb') header = [ 'ID', 'Count', 'RPKM', 'Chrom', 'Start', 'End', 'Strand', 'GeneName', 'Length', 'Type', 'Sense', 'Synonyms' ] g.write('\t'.join(header) + '\n') for line in f: loc, tid, coding, length, \ expr_fraction, expr_number, lib_fraction, lib_number, seq_fraction, seq_number, \ cov_fraction, chisq, var_coeff = line.split('\t') chrom, coord = loc.split(':') start, end = coord[:-1].split('-') strand = '1' if coord[-1] == 'W' else '-1' nreads = float(seq_number) if nreads != 0: ntotal = nreads / float(seq_fraction) rpkm = 1e9 * nreads / (float(length) * ntotal) else: rpkm = 0.0 t = tmap.get(tid) if t is not None: newline = [ tid, seq_number, str(rpkm), chrom, start, end, strand, t.gene_name, length, 'transcript', '.', '.' ] g.write('\t'.join(newline) + '\n') f.close() g.close()
def adn(self, ass, chr, id, **kw): id = int(id) g = GenRep() chrs = g.get_genrep_objects('chromosomes', 'chromosome', filters={'name': chr}, params={'assembly_id': ass}) ass = Assembly(ass) for chrid, chrs in ass.chromosomes.iteritems(): if chrs['name'] == chr: start = id * chunk end = start + chunk return g.get_sequence(chrid[0], [[start, end]]) return ''
def merge_junc_files(trackList, assembly): out = track('all.junc', format='txt', fields=['chr', 'start', 'end', 'strand', 'score']) from bbcflib.genrep import Assembly a = Assembly(assembly) for c in a.chromosomes: tl = [ track(t, fields=['chr', 'start', 'end', 'strand', 'score'], format='txt').read(str(c[0]) + '_' + c[1] + '.' + str(c[2])) for t in trackList ] #all = concatenate(tl,remove_duplicates=True) all = concatenate(tl, group_by=['chr', 'start', 'end'], aggregate={'score': lambda x: sum(x)}) out.write(all, mode='append')
def add_new_sequence(sequence): ''' Method called when a new sequence is created on GDV. It should import fast from JBrowse ''' print 'add new sequence' file_url = Assembly(sequence).get_sqlite_url() print file_url out = os.path.join(filemanager.temporary_directory(), 'Genes.sql') fileinfo = filemanager.FileInfo(inputtype='url', inpath=file_url, trackname='Genes', extension='sql', outpath=out, admin=True) print fileinfo user = DBSession.query(User).filter( User.key == constants.admin_user_key()).first() user_info = {'id': user.id, 'name': user.name, 'email': user.email} sequence_info = {'id': sequence.id, 'name': sequence.name} # track t = Track() t.name = fileinfo.trackname t.sequence_id = sequence.id t.user_id = user.id DBSession.add(t) DBSession.flush() # send task async = tasks.new_input.delay(user_info, fileinfo, sequence_info, t.id) t.task_id = async .task_id DBSession.add(t) sequence.default_tracks.append(t) DBSession.add(sequence) DBSession.flush()
def setUp(self): self.assembly = Assembly('ce6') self.root = self.assembly.genrep.root self.intype = 0 """
class Test_Assembly(unittest.TestCase): def setUp(self): self.assembly = Assembly('ce6') self.root = self.assembly.genrep.root self.intype = 0 """ Gene Y54E2A.11 (-1 to each Ensembl start by convention) 4 transcripts, Y54E2A.11a.1, Y54E2A.11a.2, Y54E2A.11b.1, Y54E2A.11b.2 5327 5434 5503 5697 5742 6075 6128 6836 6906 8367 a.1.1 |--------| b.2.2 |----| a.1.3 |------| a.1.4 |---------| a.1.5 |------| b.1.1 |------| b.1.3 |----| b.1.4 |------| a.2.5 |----| b.2.4 |----| b.2.4 |----| |========| |====| |======| |=========| |======| 2863 = 107 + 194 + 333 + 708 + 1461 """ def with_without_genrep(test): """Decorator. Runs *test* with genrep.root successively activated (via /db/) and disabled (via URL to GenRep).""" @wraps(test) # gives to the wrapper the original function name def wrapper(self): root = self.assembly.genrep.root test(self) self.assembly.genrep.root = '' test(self) self.assembly.genrep.root = root return wrapper def test_fasta_from_regions(self): expected = ({'chrI':['G','C','AAGCCTAAGCCTAAGCCTAA','CTAAGCCTAAGCCTAAGCCT','TTTTTGAAAT']}, 52) # GenRep request, list form regions = [('chrI',0,1),('chrI',1,2),('chrI',10,30),('chrI',20,40),('chrI',1010,1020)] url_seq = self.assembly.fasta_from_regions(regions=regions,out={}) self.assertEqual(url_seq, expected) # Custom fasta file, dict form regions = {'chrI':[(0,1),(1,2),(10,30),(20,40),(1010,1020)]} custom_seq = self.assembly.fasta_from_regions(regions=regions,out={}, path_to_ref=os.path.join(path,"chrI_ce6_30lines.fa")) self.assertEqual(custom_seq, expected) # Fasta from cDNA (intype=2) regions = {'chrI':[(126947,137740)]} # F53G12.5a.1, F53G12.5b, F53G12.4, F53G12.5a.2 #seq = self.assembly.fasta_from_regions(regions=regions,out="test.txt", intype=2) seq = self.assembly.fasta_from_regions(regions=regions,out={}, intype=2) self.assertEqual(seq[0]['chrI'][1][:40], "ATGCCAGTCGTGAGCGTTAGACCTTTTTCTATGAGAAATG") # F53G12.5b.1 self.assertEqual(seq[1], 5870) def test_get_features_from_gtf(self): expected = {'eif-3.B': [(14795327, 14795434, 1, 'chrII'), (14795331, 14795434, 1, 'chrII'), (14795333, 14795434, 1, 'chrII'), (14795503, 14795697, 1, 'chrII'), (14795742, 14795907, 1, 'chrII'), (14795742, 14796075, 1, 'chrII'), (14796128, 14796836, 1, 'chrII'), (14796213, 14796354, 1, 'chrII'), (14796213, 14796836, 1, 'chrII'), (14796906, 14797767, 1, 'chrII'), (14796906, 14798367, 1, 'chrII')]} h = {'keys':'gene_name', 'values':'start,end,strand', 'conditions':'gene_id:Y54E2A.11,type:exon', 'uniq':'1'} # Test with local database request zc = self.assembly.get_features_from_gtf(h, chr='chrII') self.assertItemsEqual(zc,expected) # Test with url request via GenRep self.assembly.genrep.root = '' zc = self.assembly.get_features_from_gtf(h, chr='chrII') self.assertItemsEqual(zc['eif-3.B'],expected['eif-3.B']) self.assembly.genrep.root = self.root ################ # Annot tracks # ################ @with_without_genrep def test_gene_track(self): expected = ('chrI',4118,10232,'Y74C9A.3|Y74C9A.3',-1) track = self.assembly.gene_track() self.assertEqual(track.next(),expected) @with_without_genrep def test_exon_track(self): expected = ('chrI',4118,4358,'Y74C9A.3.1.5|Y74C9A.3|Y74C9A.3',-1,'.') track = self.assembly.exon_track() self.assertEqual(track.next(),expected) @with_without_genrep def test_transcript_track(self): expected = ('chrI',4118,10232,'Y74C9A.3.1|Y74C9A.3',-1) track = self.assembly.transcript_track() self.assertEqual(track.next(),expected) ############ # Mappings # ############ @unittest.skip('slow') @with_without_genrep def test_get_gene_mapping(self): expected = ('eif-3.B',14795327,14798367,2803,1,'chrII') gmap = self.assembly.get_gene_mapping() g = gmap['Y54E2A.11'] self.assertTupleEqual((g.name,g.start,g.end,g.length,g.strand,g.chrom), expected) @unittest.skip('slow') @with_without_genrep def test_get_transcript_mapping(self): expected = ('Y54E2A.11',14795327,14798367,2803,1,'chrII') tmap = self.assembly.get_transcript_mapping() t = tmap['Y54E2A.11a.1'] self.assertTupleEqual((t.gene_id,t.start,t.end,t.length,t.strand,t.chrom), expected) @unittest.skip('slow') @with_without_genrep def test_get_exon_mapping(self): expected = (['Y54E2A.11a.1'],'Y54E2A.11','eif-3.B',14795327,14795434,1,'chrII') emap = self.assembly.get_exon_mapping() e = emap['Y54E2A.11a.1.1'] self.assertTupleEqual((e.transcripts,e.gene_id,e.gene_name,e.start,e.end,e.strand,e.chrom), expected)
#!/usr/bin/env python import sys if len(sys.argv) < 2: print "Usage: header_translation <assembly_name>" sys.exit(1) from bbcflib.genrep import Assembly assembly = sys.argv[1] a = Assembly(assembly) ac2name = {} for k, v in a.chrmeta.items(): ac2name[v['ac']] = k f = open("header.sam") #g = open("reheader.txt", "wb") h = open("reheader.sam", "wb") for line in f: L = line.split('\t') chrom = L[1].split(':')[1] length = L[2].split(':')[1] newchrom = ac2name[chrom] #g.write('%s\t%s' % (newchrom,length)) h.write(line.replace(chrom, newchrom)) f.close() g.close()
from bbcflib.genrep import Assembly a = Assembly('hg38') chrmeta = a.chrmeta md5 = "cbcc5aeeb39d29065c6641aafd5ccaa430706008" filename = "%s_ENSEMBL.gtf" % md5 to = "%s_REFSEQ.gtf" % md5 f = open(filename) g = open(to, "wb") for line in f: L = line.split('\t') ensembl = L[0] refseq = chrmeta[ensembl]['ac'] newline = [refseq] + L[1:] g.write('\t'.join(newline)) f.close() g.close()
def setUp(self): self.assembly = Assembly('ce6') self.root = self.assembly.genrep.root self.intype = 0 """
class Test_Assembly(unittest.TestCase): def setUp(self): self.assembly = Assembly('ce6') self.root = self.assembly.genrep.root self.intype = 0 """ Gene Y54E2A.11 (-1 to each Ensembl start by convention) 4 transcripts, Y54E2A.11a.1, Y54E2A.11a.2, Y54E2A.11b.1, Y54E2A.11b.2 5327 5434 5503 5697 5742 6075 6128 6836 6906 8367 a.1.1 |--------| b.2.2 |----| a.1.3 |------| a.1.4 |---------| a.1.5 |------| b.1.1 |------| b.1.3 |----| b.1.4 |------| a.2.5 |----| b.2.4 |----| b.2.4 |----| |========| |====| |======| |=========| |======| 2863 = 107 + 194 + 333 + 708 + 1461 """ def with_without_genrep(test): """Decorator. Runs *test* with genrep.root successively activated (via /db/) and disabled (via URL to GenRep).""" @wraps(test) # gives to the wrapper the original function name def wrapper(self): root = self.assembly.genrep.root test(self) self.assembly.genrep.root = '' test(self) self.assembly.genrep.root = root return wrapper def test_fasta_from_regions(self): expected = ({ 'chrI': [ 'G', 'C', 'AAGCCTAAGCCTAAGCCTAA', 'CTAAGCCTAAGCCTAAGCCT', 'TTTTTGAAAT' ] }, 52) # GenRep request, list form regions = [('chrI', 0, 1), ('chrI', 1, 2), ('chrI', 10, 30), ('chrI', 20, 40), ('chrI', 1010, 1020)] url_seq = self.assembly.fasta_from_regions(regions=regions, out={}) self.assertEqual(url_seq, expected) # Custom fasta file, dict form regions = {'chrI': [(0, 1), (1, 2), (10, 30), (20, 40), (1010, 1020)]} custom_seq = self.assembly.fasta_from_regions( regions=regions, out={}, path_to_ref=os.path.join(path, "chrI_ce6_30lines.fa")) self.assertEqual(custom_seq, expected) # Fasta from cDNA (intype=2) regions = { 'chrI': [(126947, 137740)] } # F53G12.5a.1, F53G12.5b, F53G12.4, F53G12.5a.2 #seq = self.assembly.fasta_from_regions(regions=regions,out="test.txt", intype=2) seq = self.assembly.fasta_from_regions(regions=regions, out={}, intype=2) self.assertEqual( seq[0]['chrI'][1][:40], "ATGCCAGTCGTGAGCGTTAGACCTTTTTCTATGAGAAATG") # F53G12.5b.1 self.assertEqual(seq[1], 5870) def test_get_features_from_gtf(self): expected = { 'eif-3.B': [(14795327, 14795434, 1, 'chrII'), (14795331, 14795434, 1, 'chrII'), (14795333, 14795434, 1, 'chrII'), (14795503, 14795697, 1, 'chrII'), (14795742, 14795907, 1, 'chrII'), (14795742, 14796075, 1, 'chrII'), (14796128, 14796836, 1, 'chrII'), (14796213, 14796354, 1, 'chrII'), (14796213, 14796836, 1, 'chrII'), (14796906, 14797767, 1, 'chrII'), (14796906, 14798367, 1, 'chrII')] } h = { 'keys': 'gene_name', 'values': 'start,end,strand', 'conditions': 'gene_id:Y54E2A.11,type:exon', 'uniq': '1' } # Test with local database request zc = self.assembly.get_features_from_gtf(h, chr='chrII') self.assertItemsEqual(zc, expected) # Test with url request via GenRep self.assembly.genrep.root = '' zc = self.assembly.get_features_from_gtf(h, chr='chrII') self.assertItemsEqual(zc['eif-3.B'], expected['eif-3.B']) self.assembly.genrep.root = self.root ################ # Annot tracks # ################ @with_without_genrep def test_gene_track(self): expected = ('chrI', 4118, 10232, 'Y74C9A.3|Y74C9A.3', -1) track = self.assembly.gene_track() self.assertEqual(track.next(), expected) @with_without_genrep def test_exon_track(self): expected = ('chrI', 4118, 4358, 'Y74C9A.3.1.5|Y74C9A.3|Y74C9A.3', -1, '.') track = self.assembly.exon_track() self.assertEqual(track.next(), expected) @with_without_genrep def test_transcript_track(self): expected = ('chrI', 4118, 10232, 'Y74C9A.3.1|Y74C9A.3', -1) track = self.assembly.transcript_track() self.assertEqual(track.next(), expected) ############ # Mappings # ############ @unittest.skip('slow') @with_without_genrep def test_get_gene_mapping(self): expected = ('eif-3.B', 14795327, 14798367, 2803, 1, 'chrII') gmap = self.assembly.get_gene_mapping() g = gmap['Y54E2A.11'] self.assertTupleEqual( (g.name, g.start, g.end, g.length, g.strand, g.chrom), expected) @unittest.skip('slow') @with_without_genrep def test_get_transcript_mapping(self): expected = ('Y54E2A.11', 14795327, 14798367, 2803, 1, 'chrII') tmap = self.assembly.get_transcript_mapping() t = tmap['Y54E2A.11a.1'] self.assertTupleEqual( (t.gene_id, t.start, t.end, t.length, t.strand, t.chrom), expected) @unittest.skip('slow') @with_without_genrep def test_get_exon_mapping(self): expected = (['Y54E2A.11a.1'], 'Y54E2A.11', 'eif-3.B', 14795327, 14795434, 1, 'chrII') emap = self.assembly.get_exon_mapping() e = emap['Y54E2A.11a.1.1'] self.assertTupleEqual((e.transcripts, e.gene_id, e.gene_name, e.start, e.end, e.strand, e.chrom), expected)