def test_strip_seq_by_quality_lucy():
"It tests strip_seq_by_quality_lucy2"
seq = "ATCGATCAGTCAGACTGACAGACTCAGATCAGATCAGCATCAGCATACGATACGCATCAGACT"
seq += "ACGATCGATCGATCGACAGATCATCGATCATCGACGACTAGACGATCATCGATACGCAGACTC"
seq += "AGCAGACTACGAGATCAGCAGCATCAGCAGCA"
qual = "00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 "
qual += "00 00 00 00 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 "
qual += "60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 "
qual += "60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 "
qual += "60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 "
qual += "60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 "
qual += "60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 "
qual += "60 60 60 60 60 60 60 60 60 60 60 60 60 60 00 00 00 00"
qual = qual.split()
seq = Seq(seq)
seqrec1 = SeqWithQuality(name="seq1", seq=seq, qual=qual, description="desc1")
qual = "40 40 40 37 40 40 37 37 37 37 37 37 37 37 40 42 42 42 44 44 "
qual += "56 56 42 40 40 40 40 36 36 28 35 32 35 35 40 42 37 37 35 37 "
qual += "32 35 35 35 35 35 35 38 33 33 24 33 33 42 33 35 35 35 35 33 "
qual += "36 30 30 24 29 29 35 35 35 35 29 29 29 35 38 38 38 37 35 33 "
qual += "29 35 35 34 30 30 30 33 29 31 31 29 29 29 28 28 24 21 16 16 "
qual += "21 24 29 29 32 40 27 27 25 25 21 30 27 28 28 32 23 23 21 24 "
qual += "24 17 18 19 21 15 19 11 9 9 11 23 17 15 10 10 10 20 27 25 23 "
qual += "18 22 23 24 18 10 10 13 13 18 19 10 12 12 18 16 14 10 10 11 "
qual += "16 13 21 19 31 19 27 27 28 26 29 25 25 20 19 23 28 28 19 20 "
qual += "13 9 9 9 9 9 17 15 21 17 14 12 21 17 19 24 28 24 23 "
quality = qual.split()
seq = "ATCGATCAGTCAGACTGACAGACTCAGATCAGATCAGCATCAGCATACGATACGCATCAGACT"
seq += "ACGATCGATCGATCGACAGATCATCGATCATCGACGACTAGACGATCATCGATACGCAGACTC"
seq += "AGCAGACTACGAGATCAGCAGCATCAGCAGCAAGCAGACTACGAGATCAGCAGCATCAGCAGC"
seq += "ATTACGATGAT"
seq = Seq(seq)
seqrec2 = SeqWithQuality(seq=seq, qual=quality, name="seq2", description="desc2")
seq_iter = iter([seqrec1, seqrec2])
seq_trimmer = create_seq_trim_and_masker()
lucy_striper = create_striper_by_quality_lucy()
# pylint:disable-msg=W0612
seq_iter = lucy_striper(seq_iter)
new_seqs = []
for seq in seq_iter:
new_seqs.append(seq_trimmer(seq))
seq = new_seqs[0].seq
assert seqrec1.description == new_seqs[0].description
assert seq.startswith("CAGATCAGATCAGCATCAGCAT")
assert seq.endswith("CGAGATCAGCAGCATCAGC")
assert len(new_seqs) == 2
assert new_seqs[1].description == "desc2"
# now we test the sequence with adaptors
vector_fpath = os.path.join(TEST_DATA_DIR, "lucy", "icugi_vector.fasta")
splice_fpath = os.path.join(TEST_DATA_DIR, "lucy", "icugi_splice.fasta")
parameters = {"vector": [vector_fpath, splice_fpath], "bracket": [10, 0.02]}
lucy_striper = create_striper_by_quality_lucy(parameters)
seq_fhand = open(os.path.join(TEST_DATA_DIR, "lucy", "seq_with_adaptor1.fastq"))
seq_iter = lucy_striper(seqs_in_file(seq_fhand, format="fastq"))
new_seqs = []
for seq in seq_iter:
new_seqs.append(seq_trimmer(seq))
def test_reverse_complement():
'It test the reverse complement fucntion'
sequence1 = Seq('aaaccttt')
# First we initialice the quality in the init
seq1 = SeqWithQuality(name='seq1', seq=sequence1, \
qual=[2, 4 , 1, 4, 5, 6, 12, 34])
seq2 = reverse_complement(seq1)
assert seq2.seq == sequence1.reverse_complement()
assert seq2.qual == seq1.qual[::-1]
def test_add():
'It tests the add method'
seq = Seq('AC') + Seq('TG')
assert seq == 'ACTG'
assert seq.complement() #is still a Seq
def test_complement():
'It test the Seq complement method'
seq = Seq('ACTG')
seq2 = seq.complement()
assert seq2 == 'TGAC'
def test_strip_seq_by_quality_lucy():
'It tests strip_seq_by_quality_lucy2'
seq = 'ATCGATCAGTCAGACTGACAGACTCAGATCAGATCAGCATCAGCATACGATACGCATCAGACT'
seq += 'ACGATCGATCGATCGACAGATCATCGATCATCGACGACTAGACGATCATCGATACGCAGACTC'
seq += 'AGCAGACTACGAGATCAGCAGCATCAGCAGCA'
qual = '00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 '
qual += '00 00 00 00 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 '
qual += '60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 '
qual += '60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 '
qual += '60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 '
qual += '60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 '
qual += '60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 '
qual += '60 60 60 60 60 60 60 60 60 60 60 60 60 60 00 00 00 00'
qual = qual.split()
seq = Seq(seq)
seqrec1 = SeqWithQuality(name='seq1', seq=seq, qual=qual,
description ='desc1')
qual = '40 40 40 37 40 40 37 37 37 37 37 37 37 37 40 42 42 42 44 44 '
qual += '56 56 42 40 40 40 40 36 36 28 35 32 35 35 40 42 37 37 35 37 '
qual += '32 35 35 35 35 35 35 38 33 33 24 33 33 42 33 35 35 35 35 33 '
qual += '36 30 30 24 29 29 35 35 35 35 29 29 29 35 38 38 38 37 35 33 '
qual += '29 35 35 34 30 30 30 33 29 31 31 29 29 29 28 28 24 21 16 16 '
qual += '21 24 29 29 32 40 27 27 25 25 21 30 27 28 28 32 23 23 21 24 '
qual += '24 17 18 19 21 15 19 11 9 9 11 23 17 15 10 10 10 20 27 25 23 '
qual += '18 22 23 24 18 10 10 13 13 18 19 10 12 12 18 16 14 10 10 11 '
qual += '16 13 21 19 31 19 27 27 28 26 29 25 25 20 19 23 28 28 19 20 '
qual += '13 9 9 9 9 9 17 15 21 17 14 12 21 17 19 24 28 24 23 '
quality = qual.split()
seq = 'ATCGATCAGTCAGACTGACAGACTCAGATCAGATCAGCATCAGCATACGATACGCATCAGACT'
seq += 'ACGATCGATCGATCGACAGATCATCGATCATCGACGACTAGACGATCATCGATACGCAGACTC'
seq += 'AGCAGACTACGAGATCAGCAGCATCAGCAGCAAGCAGACTACGAGATCAGCAGCATCAGCAGC'
seq += 'ATTACGATGAT'
seq = Seq(seq)
seqrec2 = SeqWithQuality(seq=seq, qual=quality, name='seq2',
description ='desc2')
seq_iter = iter([seqrec1, seqrec2])
seq_trimmer = create_seq_trim_and_masker()
lucy_striper = create_striper_by_quality_lucy()
#pylint:disable-msg=W0612
seq_iter = lucy_striper(seq_iter)
new_seqs = []
for seq in seq_iter:
new_seqs.append(seq_trimmer(seq))
seq = new_seqs[0].seq
assert seqrec1.description == new_seqs[0].description
assert seq.startswith('CAGATCAGATCAGCATCAGCAT')
assert seq.endswith('CGAGATCAGCAGCATCAGC')
assert len(new_seqs) == 2
assert new_seqs[1].description == 'desc2'
# now we test the sequence with adaptors
vector_fpath = os.path.join(TEST_DATA_DIR, 'lucy', 'icugi_vector.fasta')
splice_fpath = os.path.join(TEST_DATA_DIR, 'lucy', 'icugi_splice.fasta')
parameters = {'vector':[vector_fpath, splice_fpath],
'bracket':[10, 0.02]}
lucy_striper = create_striper_by_quality_lucy(parameters)
seq_fhand = open(os.path.join(TEST_DATA_DIR, 'lucy',
'seq_with_adaptor1.fastq'))
seq_iter = lucy_striper(seqs_in_file(seq_fhand, format='fastq'))
new_seqs = []
for seq in seq_iter:
new_seqs.append(seq_trimmer(seq))