def loop():
'''This function is called over and over again.'''
global i
# do something arbitray. To be adapted.
# create a list robot queries, one for each of the robots
RQS = [MemeSimCommand.RQ(TEAM_NUMBER, (TEAM_NUMBER-1)*3+r) for r in range(1, 2)]
# add a request to check the account balance
RQS.append(MemeSimCommand.CA(TEAM_NUMBER))
RQS.append(MemeSimCommand.RS(TEAM_NUMBER,10,150,150,(i/360)*2*pi))
i=i+5
# send the requests to the simulator
for req in RQS:
MEMESIM_CLIENT.send_command(req)
# make a random mutation to some meme at a random position
MY_MEMES['Meme1'][randint(0, 99)] = MemeGenome.Nucleotides[randint(0, 3)]
# show the meme in the GUI
MEMESIM_GUI.show_meme(MY_MEMES['Meme1'])
def setup():
''' The setup function is called once at startup. You can put initialization code here. '''
# create a collection of random memes
for i in range(1, 11):
mgen = MemeGenome.random_meme_genome()
# do some arbitrary things to it
mgen[0] = 'A'
mgen[99] = mgen[0]
# store the meme in the dictionary MY_MEMES under a name as a string
MY_MEMES['Meme'+str(i)] = mgen
# try to connect to the simulator
if not MEMESIM_CLIENT.connect():
print("Could not connect to the simulator.")
exit()
# create a list robot queries, one for each of the robots
RQS = [MemeSimCommand.RQ(TEAM_NUMBER, (TEAM_NUMBER-1)*3+r) for r in range(1, 2)]
# add a request to check the account balance
RQS.append(MemeSimCommand.CA(TEAM_NUMBER))
RQS.append(MemeSimCommand.RS(TEAM_NUMBER,10,150,150,2*pi))
RQS.append(MemeSimCommand.RS(TEAM_NUMBER,11,150,150,2*pi))
RQS.append(MemeSimCommand.RS(TEAM_NUMBER,12,150,150,2*pi))
# send the requests to the simulator
for req in RQS:
MEMESIM_CLIENT.send_command(req)
RESPONSES = MEMESIM_CLIENT.new_responses()
def loop(mode):
'''This function is called over and over again.'''
if mode == 'rq':
# create a list robot queries, one for each of the robots
RQS = [MemeSimCommand.RQ(TEAM_NUMBER, Robot)]
elif mode == 'mq':
# add a request to check the account balance
#res() so as to auto reset every market research
number = input("How many individuals?")
global nrofinterviews
nrofinterviews = number
RQS = [MemeSimCommand.MQ(TEAM_NUMBER, Robot, number)]
elif mode == 'ip':
#print(People)
pseudoID = int(input("Person to interview:"))
RQS = [MemeSimCommand.IP(TEAM_NUMBER, Robot, People[pseudoID][2])]
Database.append(People[pseudoID])
print(Database)
elif mode == 'pi':
for i in range(0, len(Database)):
print(i, "numero:", Database[i][1])
RQS = [MemeSimCommand.PI(TEAM_NUMBER, Robot, Database[i][2])]
for req in RQS:
MEMESIM_CLIENT.send_command(req)
sleep(1)
elif mode == 'tm':
#genome=input("insert meme genome=")
pseudoID = int(input("ID of the individual:"))
meme_gen = ProduceGenome()
RQS = [
MemeSimCommand.TM(TEAM_NUMBER, Robot, meme_gen,
Database[pseudoID][2])
]
elif mode == 'pc':
memeName = input("Insert meme name:")
meme_gen = ProduceGenome()
RQS = [MemeSimCommand.PC(TEAM_NUMBER, Robot, memeName, meme_gen)]
elif mode == 'lc':
memeName = input("Insert meme name:")
budget = int(input("Budeget:"))
RQS = [MemeSimCommand.LC(TEAM_NUMBER, Robot, memeName, budget)]
elif mode == 'db':
RQS = [MemeSimCommand.DB(TEAM_NUMBER, 'money')]
elif mode == 'set':
xpos = int(input("Position x-axis:"))
ypos = int(input("Position y-axis:"))
angle = 20
RQS = [MemeSimCommand.RS(TEAM_NUMBER, Robot, xpos, ypos, 20)]
RQS.append(MemeSimCommand.CA(TEAM_NUMBER))
#RQS.append(MemeSimCommand.MQ(4,10,20))
#i=i+1
# send the requests to the simulator
if mode != 'pi':
for req in RQS:
MEMESIM_CLIENT.send_command(req)
def loop(mode):
'''This function is called over and over again.'''
if mode=='rq':
# create a list robot queries, one for each of the robots
RQS = [MemeSimCommand.RQ(TEAM_NUMBER,Robot) ]
elif mode=='mq':
# add a request to check the account balance
number=input("How many individuals?")
global nrofinterviews
nrofinterviews = number
RQS=[MemeSimCommand.MQ(TEAM_NUMBER,Robot,number)]
elif mode=='ip':
ID=input("ID of the individual to interview")
RQS= [MemeSimCommand.IP(TEAM_NUMBER,Robot,ID)]
elif mode=='pi':
ID=input("ID of the individual to interview")
RQS= [MemeSimCommand.PI(TEAM_NUMBER,Robot,ID)]
elif mode=='tm':
#genome=input("insert meme genome=")
ID=input("ID of the individual")
meme_gen='CCCTTTAAACCCTTTAAACCCTTTAAACCCTTTAAACCCTTTAAACCCTTTAAACCCTTTAAACCCTTTAAACCCTTTAAACCTTTAAACCCTTTAAACC'
RQS= [MemeSimCommand.TM(TEAM_NUMBER,Robot,meme_gen,ID)]
elif mode=='pc':
memeN=input("insert meme name=")
meme_gen='CCCTTTAAACCCTTTAAACCCTTTAAACCCTTTAAACCCTTTAAACCCTTTAAACCCTTTAAACCCTTTAAACCCTTTAAACCTTTAAACCCTTTAAACC'
RQS= [MemeSimCommand.PC(TEAM_NUMBER,Robot,memeN,meme_gen)]
elif mode=='lc':
memeN=input("insert meme name=")
RQS=[MemeSimCommand.LC(TEAM_NUMBER,Robot,memeN,100)]
elif mode=='db':
RQS=[MemeSimCommand.DB(TEAM_NUMBER,'reset')]
elif mode=='eur':
RQS=[MemeSimCommand.DB(TEAM_NUMBER,'reset')]
elif mode=='set':
xpos=int(input("xpos="))
ypos=int(input("ypos="))
angle=20
RQS=[MemeSimCommand.RS(TEAM_NUMBER,Robot,xpos,ypos,20)]
RQS.append(MemeSimCommand.CA(TEAM_NUMBER))
#RQS.append(MemeSimCommand.MQ(4,10,20))
#i=i+1
# send the requests to the simulator
for req in RQS:
MEMESIM_CLIENT.send_command(req)
# make a random mutation to some meme at a random position
MY_MEMES['Meme1'][randint(0, 99)] = MemeGenome.Nucleotides[randint(0, 3)]
# show the meme in the GUI
MEMESIM_GUI.show_meme(MY_MEMES['Meme1'])
def GetPosition(robotID):
RQ = MemeSimCommand.RQ(8, robotID+14)
MEMESIM_CLIENT.send_command(RQ)
time.sleep(1.0)
RESPONSES1 = MEMESIM_CLIENT.new_responses()
for resp1 in RESPONSES1:
if resp1.cmdtype() == 'rq':
if not resp1.iserror():
xpos = int(float(resp1.cmdargs()[2]))
ypos = int(float(resp1.cmdargs()[3]))
angle = round(math.degrees(float(resp1.cmdargs()[4])))
if abs(angle) > 180:
angle = angle - sign(angle) * 360
return [xpos, ypos], angle
return
def update_position(robot_id):
RQ1 = MemeSimCommand.RQ(4, robot_id) #make a request
MEMESIM_CLIENT.send_command(RQ1) #send request
sleep(0.2) #wait a bit
update_responses() #find answers to responses: to x, y and angle
def loop():
repeatCmd = False
global tr2
global tr1
global CityIDGen
global CityID
global city
global MY_MEMES
error = 0
print(
"What do you want to do? (rq/mqip/genmeme/genmemes/tm/pc/lc/ca/db/rs/quit/print_ind/litt/save/read/dest)"
)
command = input()
if "*" in command:
command = command.replace("*", "")
repeatCmd = True
if command == "rq":
print("location of which robot? 1(henk)/2(ingrid)")
robotID = int(input()) + 14
RQ1 = MemeSimCommand.RQ(8, robotID)
elif command == "mq": # need to store city number
print("Query with which robot? 1(henk)/2(ingrid)")
robotID = int(input()) + 14
print("For what group size?")
group_size = int(input())
RQ1 = MemeSimCommand.MQ(8, robotID, group_size)
elif command == "ip":
print("Interview person with which robot? 1(henk)/2(ingrid)")
robotID = int(input()) + 14
print("Which person do you want to interview?")
individualID = int(float(input()))
RQ1 = MemeSimCommand.IP(8, robotID, individualID)
elif command == "mqip": # need to store city number
print("Query and interview with which robot? 1(henk)/2(ingrid)")
robotID = int(input()) + 14
print("For what group size?")
group_size = int(input())
print("In which city are you?")
city = int(input())
RQ1 = MemeSimCommand.MQ(8, robotID, group_size)
elif command == "pi": # need to store city number
print("Process interview with which robot? 1(henk)/2(ingrid)")
robotID = int(input()) + 14
print("Which person was interviewed?")
individualID = input()
RQ1 = MemeSimCommand.PI(8, robotID, individualID)
elif command == 'genmeme':
print("Process interview with which robot? 1(henk)/2(ingrid)")
robotID = int(input()) + 14
print("For which city do you want to generate a meme?")
city = int(input())
print("What do you want to call the meme?")
memename = input()
print("What protocol do you want to use?")
protocol = int(input())
genmeme(robotID, memename, protocol)
error = 1
elif command == 'genmemes':
print("Process interview with which robot? 1(henk)/2(ingrid)")
robotID = int(input()) + 14
print("For which city do you want to generate a meme?")
city = int(input())
print("What do you want to call the meme?")
memename = input()
genmemes(robotID, memename)
error = 1
#
# elif command == 'gm':
# print("For which city do you want to generate a meme?")
# citynr = int(input())
# print("What do you want to call the meme?")
# memename = input()
# print("What protocol do you want to use?")
# protocol = int(input())
# genomes_to_send = []
# for i in range(len(CityIDGen)):
# if CityIDGen[i][0] == citynr:
# genomes_to_send += [CityIDGen[i][2]]
# print(genomes_to_send)
# averageGenome = getAverage(genomes_to_send)
# print(averageGenome)
# MY_MEMES += genome_protocol(protocol, averageGenome)
# error = 1 bla
elif command == "tm":
found = False
print("Test meme with which robot? 1(henk)/2(ingrid)")
robotID = int(input()) + 14
print("Which meme?")
meme_name = input()
print("Which person do you want to test on?")
individualID = input()
for i in range(len(MY_MEMES)):
if MY_MEMES[i][0] == meme_name:
meme_genome = MY_MEMES[i][1]
found = True
if found == True:
RQ1 = MemeSimCommand.TM(8, robotID, meme_genome, individualID)
else:
print("That meme does not excist")
error = 1
found = False
elif command == "pc":
print("Process campaign with which robot? 1(henk)/2(ingrid)")
robotID = int(input()) + 14
print("Which meme?")
meme_name = input()
for i in range(len(MY_MEMES)):
if MY_MEMES[i][0] == meme_name:
meme_genome = MY_MEMES[i][1]
found = true
if found == true:
RQ1 = MemeSimCommand.PC(8, robotID, meme_name, meme_genome)
else:
print("That meme does not excist")
error = 1
found = false
elif command == "lc":
print("Launch campaign with which robot? 1(henk)/2(ingrid)")
robotID = int(input()) + 14
print("What meme do you want to launch?"
) # optie voor later: print lijst met alle memes
meme_name = input()
print("What is the budget?")
budget = input()
RQ1 = MemeSimCommand.LC(8, robotID, meme_name, budget)
elif command == "ca":
RQ1 = MemeSimCommand.CA(8)
elif command == "db":
print("What do you want to do? money/reset")
debug_command = input()
RQ1 = MemeSimCommand.DB(8, debug_command)
elif command == "rs":
print("Set location of which robot? 1(henk)/2(ingrid)")
robotID = int(input()) + 14
print("At which x_position? (in mm)")
x_pos = input()
print("At which y_position? (in mm)")
y_pos = input()
print("At what angle?")
angle = input()
RQ1 = MemeSimCommand.RS(8, robotID, x_pos, y_pos, angle)
elif command == "quit":
exit()
elif command == "print_ind":
print(CityIDGen)
error = 1
elif command == "litt":
print("Geef input")
testcmd = input()
exec(testcmd)
error = 1
elif command == "save":
print("Saving meme genome")
write_genome(CityIDGen)
error = 1
elif command == "dest":
print("Input destination 1")
testTr = input()
print("Input destination 2")
testTr = input()
error = 1
elif command == "read":
print("Reading meme genome")
read_genome(CityIDGen)
error = 1
else:
print("error")
error = 1
# do something arbitray with the memes
if error == 0:
MEMESIM_CLIENT.send_command(RQ1)
if repeatCmd:
sleep(sleep_length)
RESPONSES = MEMESIM_CLIENT.new_responses()
# process new responses
for r in RESPONSES:
process_response(r)
loop()