def _parse(self):
tmp_ct = []
defline = ">"
for line in open(self.ct_path):
if line.startswith('#'):
defline += line.strip() + '|'
else:
tmp_ct.append(line)
defline = defline.replace('\n', '').replace('#', '')
# just one entry per file
result = ct_parser(tmp_ct)[0]
sequence = result[0]
# IMPORTANT!
# ct_parser starts numbering of base pairs from 0, not from 1, as
# elsewhere in nucleic.secstruc. To make things consistent, here
# we'll add 1 to each index in base pairs list!
result_1 = [(pair[0] + 1, pair[1] + 1) for pair in result[1]]
pairs = BasePairs(result_1)
if self._is_valid_sequence(sequence):
sequence = Sequence(sequence.upper()).seq_without_modifications
# Second check, because ModeRNA might also mix a bit at this stage
# including for exampel X in sequences without modifications!
if self._is_valid_sequence(sequence):
try:
vienna = pairs.toVienna(len(sequence))
except PseudoknotTokensError:
vienna = None
finally:
return defline, sequence, vienna, pairs
return None, None, None, None
def test_gap_structure2_model(self):
"""
Should create model with no gaps.
Template: 1H3E B (whole structure)
Target: 1WZ2 C (whole structure)
"""
t = load_template('test_data/gaps/1h3e_B.pdb', 'B')
print examine_structure(t)
print t['16']
a = load_alignment('test_data/gaps/structure2_alignment.fasta')
print a
m = create_model(t, a)
os.system('mkdir -p test_data/gaps/structure2_candidates1')
old_candidates = os.listdir('test_data/gaps/structure2_candidates1')
for x in old_candidates:
if x.startswith('model'):
os.remove('test_data/gaps/structure2_candidates1/' + x)
print m
write_model(
m, 'test_data/gaps/structure2_candidates1/model_structure2.pdb')
self.assertEqual(
m.get_sequence(),
Sequence(
'GCGGGGGUUGCCGAGCCUGGUCAAAGGCGGGGGACUCAAGAUCCCCUCCCGUA.GGGUUCCGGGGUUCGAAUCCCCGCCCCCGCACCA'
))
def test_gap3_model(self):
"""
Should create model with no gaps.
Template: 1QF6 B (fragment)
Target: 1B23 R (fragment)
"""
t = load_template('test_data/gaps/gap3_template.pdb', 'B')
a = load_alignment('test_data/gaps/gap3_alignment.fasta')
m = create_model(t, a)
os.system('mkdir -p test_data/gaps/gap3_candidates')
old_candidates = os.listdir('test_data/gaps/gap3_candidates')
for x in old_candidates:
if x.startswith('model'):
os.remove('test_data/gaps/gap3_candidates/' + x)
write_model(m, 'test_data/gaps/gap3_candidates/model3.pdb')
self.assertEqual(m.get_sequence(), Sequence('CUAGUC'))
def test_gap1_model(self):
"""
Should create model with no gaps.
Template: 1B23 (fragment)
Target: 1EHZ (fragment)
"""
t = load_template('test_data/gaps/gap1_template.pdb', 'B')
a = load_alignment('test_data/gaps/gap1_alignment.fasta')
m = create_model(t, a)
os.system('mkdir -p test_data/gaps/gap1_candidates')
old_candidates = os.listdir('test_data/gaps/gap1_candidates')
for x in old_candidates:
if x.startswith('model'):
os.remove('test_data/gaps/gap1_candidates/' + x)
m.write_pdb_file('test_data/gaps/gap1_candidates/model1.pdb')
self.assertEqual(m.get_sequence(), Sequence('AGDDGGG'))
def test_gap7_model(self):
"""
Should create model with no gaps.
Template: 2CV2 D (fragment)
Target: 1WZ2 C (fragment)
"""
t = load_template('test_data/gaps/gap7_template.pdb', 'D')
a = load_alignment('test_data/gaps/gap7_alignment.fasta')
m = create_model(t, a)
os.system('mkdir -p test_data/gaps/gap7_candidates1')
old_candidates = os.listdir('test_data/gaps/gap7_candidates1')
for x in old_candidates:
if x.startswith('model'):
os.remove('test_data/gaps/gap7_candidates1/' + x)
write_model(m, 'test_data/gaps/gap7_candidates1/model7.pdb')
self.assertEqual(m.get_sequence(), Sequence('AGCCUGGUCAAA'))
def test_gap6_model(self):
"""
Should create model with no gaps.
Template: 2V0G B (fragment)
Target: 1GTS B (fragment)
"""
# Template has letters in original numeration.
t = load_template('test_data/gaps/gap6_template.pdb', 'B')
a = load_alignment('test_data/gaps/gap6_alignment.fasta')
m = create_model(t, a)
os.system('mkdir -p test_data/gaps/gap6_candidates')
old_candidates = os.listdir('test_data/gaps/gap6_candidates')
for x in old_candidates:
if x.startswith('model'):
os.remove('test_data/gaps/gap6_candidates/' + x)
write_model(m, 'test_data/gaps/gap6_candidates/model6.pdb')
self.assertEqual(m.get_sequence(), Sequence('UUCCGA'))
def test_gap5_model(self):
"""
Should create model with no gaps.
Template: 1WZ2 C (fragment)
Target: 1B23 R (fragment)
"""
# Won't find gap automaticly.
t = load_template('test_data/gaps/gap5_template.pdb', 'C')
a = load_alignment('test_data/gaps/gap5_alignment.fasta')
m = create_model(t, a)
os.system('mkdir -p test_data/gaps/gap5_candidates')
old_candidates = os.listdir('test_data/gaps/gap5_candidates')
for x in old_candidates:
if x.startswith('model'):
os.remove('test_data/gaps/gap5_candidates/' + x)
write_model(m, 'test_data/gaps/gap5_candidates/model5.pdb')
self.assertEqual(m.get_sequence(), Sequence('GUCUAGU'))
def test_gap_structure1_model(self):
"""
Should create model with no gaps.
Template: 1H4S T (whole structure)
Target: 1EHZ A (whole structure)
"""
t = load_template('test_data/gaps/1h4s_T.pdb', 'T')
a = load_alignment('test_data/gaps/structure1_alignment.fasta')
m = create_model(t, a)
os.system('mkdir -p test_data/gaps/structure1_candidates1')
old_candidates = os.listdir('test_data/gaps/structure1_candidates1')
for x in old_candidates:
if x.startswith('model'):
os.remove('test_data/gaps/structure1_candidates1/' + x)
write_model(
m, 'test_data/gaps/structure1_candidates1/model_structure1.pdb')
self.assertEqual(
m.get_sequence(),
Sequence(
'GCGGAUUUALCUCAGDDGGGAGAGCRCCAGABU#AAYAP?UGGAG7UC?UGUGTPCG"UCCACAGAAUUCGCACCA'
))