def setUp(self):
plugin("https://localhost:21174", 'register', 'ignored')
db_path = os.environ["QC_FILTER_DB_DP"]
self.params = {
'Bowtie2 database to filter': join(db_path, 'phix/phix'),
'Number of threads': '5'
}
self._clean_up_files = []
def setUp(self):
plugin("https://localhost:21174", 'register', 'ignored')
out_dir = mkdtemp()
self.maxDiff = None
self.out_dir = out_dir
self.db_path = os.environ["QC_SHOGUN_DB_DP"]
self.params = {
'Database': join(self.db_path, 'shogun'),
'Aligner tool': 'bowtie2',
'Number of threads': 1
}
self._clean_up_files = []
self._clean_up_files.append(out_dir)
def setUp(self):
plugin("https://localhost:21174", 'register', 'ignored')
# to fully test the plugin we need to use the demo reference-db,
# which is part of the regular trim install
self.refdb_path = join(dirname(kd.__file__),
"tests/data/demo_bowtie2_db/demo_db.1.bt2")
self.params = {
'Fwd read adapter': 'GATCGGAAGAGCACACGTCTGAACTCCAGTCAC',
'Rev read adapter': 'GATCGGAAGAGCGTCGTGTAGGGAAAGGAGTGT',
'Trim low-quality bases': '15',
'Minimum trimmed read length': '80',
'Pair-end read required to match': 'any',
'Maximum number of N bases in a read to keep it': '80',
'Trim Ns on ends of reads': True,
'NextSeq-specific quality trimming': False,
'Number of threads used': '5'
}
self._clean_up_files = []
def setUp(self):
plugin("https://localhost:21174", 'register', 'ignored')
out_dir = mkdtemp()
self.maxDiff = None
self.out_dir = out_dir
self.db_path = os.environ["QC_SHOGUN_DB_DP"]
self.params = {
'Database': join(self.db_path, 'rep82'),
'Aligner tool': 'bowtie2',
'Number of threads': 5,
'Capitalist': False,
'Percent identity': 0.95,
}
self._clean_up_files = []
self._clean_up_files.append(out_dir)
self.enzymes = ('K00001\t'
'"1. Oxidoreductases"\t'
'"1.1 Acting on the CH-OH group of donors"\t'
'"1.1.1 With NAD+ or NADP+ as acceptor"\t'
'"1.1.1.1 alcohol dehydrogenase"\n'
'K00002\t'
'"1. Oxidoreductases"\t'
'"1.1 Acting on the CH-OH group of donors"\t'
'"1.1.1 With NAD+ or NADP+ as acceptor"\t'
'"1.1.1.2 alcohol dehydrogenase (NADP+)"\n'
'K00003\t'
'"1. Oxidoreductases"\t'
'"1.1 Acting on the CH-OH group of donors"\t'
'"1.1.1 With NAD+ or NADP+ as acceptor"\t'
'"1.1.1.3 homoserine dehydrogenase"')
self.enz_md = {
'K00001': {'taxonomy': ['1. Oxidoreductases',
'1.1 Acting on the CH-OH group of donors',
'1.1.1 With NAD+ or NADP+ as acceptor',
'1.1.1.1 alcohol dehydrogenase']},
'K00002': {'taxonomy': ['1. Oxidoreductases',
'1.1 Acting on the CH-OH group of donors',
'1.1.1 With NAD+ or NADP+ as acceptor',
'1.1.1.2 alcohol dehydrogenase (NADP+)']},
'K00003': {'taxonomy': ['1. Oxidoreductases',
'1.1 Acting on the CH-OH group of donors',
'1.1.1 With NAD+ or NADP+ as acceptor',
'1.1.1.3 homoserine dehydrogenase']}}
self.modules = (
'K00003\t'
'"Pathway module"\t'
'"Nucleotide and amino acid metabolism"\t'
'"Cysteine and methionine metabolism"\t'
'"M00017 Methionine biosynthesis,'
' apartate => homoserine => methionine [PATH:map00270]"\n'
'K00003\t'
'"Pathway module"\t'
'"Nucleotide and amino acid metabolism"\t'
'"Serine and threonine metabolism"\t'
'"M00018 Threonine biosynthesis, '
'apartate => homoserine => threonine [PATH:map00260]"\n'
'K00133\t'
'"Pathway module"\t'
'"Nucleotide and amino acid metabolism"\t'
'"Cysteine and methionine metabolism"\t'
'"M00017 Methionine biosynthesis,'
' apartate => homoserine => methionine [PATH:map00270]"')
self.mod_md = {
'M00017': {'taxonomy': ['Pathway module',
'Nucleotide and amino acid metabolism',
'Cysteine and methionine metabolism',
'Methionine biosynthesis,' +
' apartate => homoserine => ' +
'methionine [PATH:map00270]']},
'M00018': {'taxonomy': ['Pathway module',
'Nucleotide and amino acid metabolism',
'Serine and threonine metabolism',
'Threonine biosynthesis,' +
' apartate => homoserine => ' +
'threonine [PATH:map00260]']}}
self.pathways = ('K00271\t'
'"Enzymes"\t'
'"1. Oxidoreductases"\t'
'"1.4 Acting on the CH-NH2 group of donors"\t'
'"1.4.1 With NAD+ or NADP+ as acceptor"\t'
'"1.4.1.23 valine dehydrogenase (NAD+)"\n'
'K00272\t'
'"Enzymes"\t'
'"1. Oxidoreductases"\t'
'"1.4 Acting on the CH-NH2 group of donors"\t'
'"1.4.3 With oxygen as acceptor"\t'
'"1.4.3.1 D-aspartate oxidase"\n'
'K00273\t'
'"Enzymes"\t'
'"1. Oxidoreductases"\t'
'"1.4 Acting on the CH-NH2 group of donors"\t'
'"1.4.3 With oxygen as acceptor"\t'
'"1.4.3.3 D-amino-acid oxidase"')
self.path_md = {
'1.4.1 With NAD+ or NADP+ as acceptor': {
'taxonomy': ['Enzymes',
'1. Oxidoreductases',
'1.4 Acting on the CH-NH2 group of donors']},
'1.4.3 With oxygen as acceptor': {
'taxonomy': ['Enzymes',
'1. Oxidoreductases',
'1.4 Acting on the CH-NH2 group of donors']}}