def test_write_sequences_to_fasta_file(self):
"""Tests writing to a FASTA file"""
seqs = st.read_sequences_from_fasta_file('testdata/fasta_test.fa')
with open('/tmp/fasta_tmp.fa', 'w') as outputfile:
st.write_sequences_to_fasta_file(outputfile, seqs)
seqs2 = st.read_sequences_from_fasta_file('/tmp/fasta_tmp.fa')
self.assertEquals(seqs, seqs2)
def test_write_sequences_to_fasta_file(self):
"""Tests writing to a FASTA file"""
seqs = st.read_sequences_from_fasta_file('testdata/fasta_test.fa')
with open('/tmp/fasta_tmp.fa', 'w') as outputfile:
st.write_sequences_to_fasta_file(outputfile, seqs)
seqs2 = st.read_sequences_from_fasta_file('/tmp/fasta_tmp.fa')
self.assertEquals(seqs, seqs2)
def test_write_sequences_to_fasta_file_empty_seqs(self):
"""Tests ensures that only non-empty sequences will be written to FASTA"""
seqs = [['seq1', 'TATATA'], ['seq2', '']]
with open('/tmp/fasta_tmp.fa', 'w') as outputfile:
st.write_sequences_to_fasta_file(outputfile, seqs)
seqs2 = st.read_sequences_from_fasta_file('/tmp/fasta_tmp.fa')
self.assertEquals(1, len(seqs2))
self.assertEquals(seqs[0][0], seqs2[0][0])
self.assertEquals(seqs[0][1], seqs2[0][1])
def test_write_sequences_to_fasta_file_empty_seqs(self):
"""Tests ensures that only non-empty sequences will be written to FASTA"""
seqs = [['seq1', 'TATATA'], ['seq2', '']]
with open('/tmp/fasta_tmp.fa', 'w') as outputfile:
st.write_sequences_to_fasta_file(outputfile, seqs)
seqs2 = st.read_sequences_from_fasta_file('/tmp/fasta_tmp.fa')
self.assertEquals(1, len(seqs2))
self.assertEquals(seqs[0][0], seqs2[0][0])
self.assertEquals(seqs[0][1], seqs2[0][1])
def test_read_sequences_from_fasta_file(self):
"""test reading sequences from a string in FASTA format"""
with open("testdata/fasta_test.fa") as inputfile:
fasta_string = inputfile.read()
seqs = st.read_sequences_from_fasta_file('testdata/fasta_test.fa')
self.assertEquals(7, len(seqs))
seq = ("CCGAGGAAGACAGACGCAATTTCACATCGAACTCGTGTACGGCATCCTCT" +
"TTATTGCCGGCTTTGCTTTTCTCGTCTTCCGCGTCGATCCCCGGGTGGCA" +
"GCGTTCGAAGGAGGTCTCGTCATTGGTTACTTATTGAGAATTTAGGGGAA" +
"AATGTCAATCTACGAGTGGA")
self.assertEquals('VNG6198H', seqs[6][0])
self.assertEquals(seq, seqs[6][1])
def test_read_sequences_from_fasta_file(self):
"""test reading sequences from a string in FASTA format"""
with open("testdata/fasta_test.fa") as inputfile:
fasta_string = inputfile.read()
seqs = st.read_sequences_from_fasta_file('testdata/fasta_test.fa')
self.assertEquals(7, len(seqs))
seq = ("CCGAGGAAGACAGACGCAATTTCACATCGAACTCGTGTACGGCATCCTCT" +
"TTATTGCCGGCTTTGCTTTTCTCGTCTTCCGCGTCGATCCCCGGGTGGCA" +
"GCGTTCGAAGGAGGTCTCGTCATTGGTTACTTATTGAGAATTTAGGGGAA" +
"AATGTCAATCTACGAGTGGA")
self.assertEquals('VNG6198H', seqs[6][0])
self.assertEquals(seq, seqs[6][1])
def make_sequences( genome_fasta_file, gene_features_file,
outfile='sequences.csv', distance={'upstream':300,'downstream':100}, from_end=False, fasta=False ):
if from_end:
distance = ( distance['upstream'], distance['downstream'] )
else:
'''WARNING: as of 2012-03-22, the st.extract functions used flipped distances!
e.g. distance[1] is the UPSTREAM distance and distance[0] is the DOWNSTREAM
CHECK YOUR SEQUENCES after running this! Also, a negative number is expected for
DOWNSTREAM. So, (-100,300) must be passed to st.extract_upstream in order to get
a sequence from 300 upstream to 100 downstream. WEIRD!'''
distance = (-1*distance['downstream'],distance['upstream'])
contig_sequences = st.read_sequences_from_fasta_file( genome_fasta_file )
# convert contig_sequences to dictionary (this func returns a list of tuples)
contig_dict = {}
for name, seq in contig_sequences:
contig_dict[name] = seq
print 'loaded %i contigs' %len(contig_dict)
print string.join( [ '%s: %ibp' %(a,len(b)) for a,b in contig_dict.items()] , ',' )
features = st.read_features_from_file( gene_features_file )
print 'loaded %i features' %len(features)
# print str(features.values()[1])
sequences = []
for feature in features.values():
location = feature.location()
# print location, location.contig, distance, feature.id()
if from_end:
sequences.append( ( feature.id(), st.extract_downstream(contig_dict[location.contig], location, distance)[1] ) )
else:
sequences.append( ( feature.id(), st.extract_upstream(contig_dict[location.contig], location, distance)[1] ) )
# print sequences[feature.id()]
outf = open(outfile,'w')
if fasta: st.write_sequences_to_fasta_file(outf,sequences)
else:
sep = ','
for id, seq in sequences:
outf.write( '%s%s%s\n' %(id,sep,seq) )
outf.close()
def make_sequences( genome_fasta_file, gene_features_file,
outfile='sequences.csv', distance={'upstream':300,'downstream':100}, from_end=False, fasta=False ):
if from_end:
distance = ( distance['upstream'], distance['downstream'] )
else:
'''WARNING: as of 2012-03-22, the st.extract functions used flipped distances!
e.g. distance[1] is the UPSTREAM distance and distance[0] is the DOWNSTREAM
CHECK YOUR SEQUENCES after running this! Also, a negative number is expected for
DOWNSTREAM. So, (-100,300) must be passed to st.extract_upstream in order to get
a sequence from 300 upstream to 100 downstream. WEIRD!'''
distance = (-1*distance['downstream'],distance['upstream'])
contig_sequences = st.read_sequences_from_fasta_file( genome_fasta_file )
# convert contig_sequences to dictionary (this func returns a list of tuples)
contig_dict = {}
for name, seq in contig_sequences:
contig_dict[name] = seq
print 'loaded %i contigs' %len(contig_dict)
print string.join( [ '%s: %ibp' %(a,len(b)) for a,b in contig_dict.items()] , ',' )
features = st.read_features_from_file( gene_features_file )
print 'loaded %i features' %len(features)
# print str(features.values()[1])
sequences = []
for feature in features.values():
location = feature.location
# print location, location.contig, distance, feature.id
if from_end:
sequences.append( ( feature.id, st.extract_downstream(contig_dict[location.contig], location, distance)[1] ) )
else:
sequences.append( ( feature.id, st.extract_upstream(contig_dict[location.contig], location, distance)[1] ) )
# print sequences[feature.id]
outf = open(outfile,'w')
if fasta: st.write_sequences_to_fasta_file(outf,sequences)
else:
sep = ','
for id, seq in sequences:
outf.write( '%s%s%s\n' %(id,sep,seq) )
outf.close()
htmlfile.write('<h3>Interesting motifs (not highest-ranking) can also be:</h3>')
has_advice = False
if len(buckets[i]) > 0:
pat_index = 0
seekpat = buckets[i][pat_index]
if seekpat.score > 0:
pat_index += 1
if seekpat.usable():
output_pattern(htmlfile, seekpat, seqs, reverse)
htmlfile.write("</body></html>")
if __name__ == '__main__':
print "Adviser Python"
if len(sys.argv) <= 1:
print "usage: python adviser.py <fasta-file> [S]"
else:
basename = sys.argv[1]
reverse = False
print "Processing '%s'" % basename
seqs = st.read_sequences_from_fasta_file(basename)
mixfile = '%s.mix' % basename
print "Running adviser on '%s'" % mixfile
mix_entries = read_mixfile(mixfile) # seems correct
buckets = make_buckets(mix_entries) # seems correct
compute_pattern_relationships(buckets, reverse) # seems correct
search_patterns(buckets, seqs, reverse) # fixed
output_results(seqs, mix_entries, buckets, sys.argv[1], reverse)
