def most_common(self, n=None):
'''List the n most common elements and their counts from the most
common to the least. If n is None, then list all element counts.
>>> Counter('abcdeabcdabcaba').most_common(3)
[('a', 5), ('b', 4), ('c', 3)]
'''
# Emulate Bag.sortedByCount from Smalltalk
if n is None:
return sorted(self.items(), key=_itemgetter(1), reverse=True)
return _heapq.nlargest(n, self.items(), key=_itemgetter(1))
def most_common(self, n=None):
'''List the n most common elements and their counts from the most
common to the least. If n is None, then list all element counts.
>>> Counter('abracadabra').most_common(3)
[('a', 5), ('r', 2), ('b', 2)]
'''
# Emulate Bag.sortedByCount from Smalltalk
if n is None:
return sorted(self.iteritems(), key=_itemgetter(1), reverse=True)
# Modified to avoid use of _heapq
return sorted(self.iteritems(), key=_itemgetter(1), reverse=True)[:n]
def print_result(counter):
sum_ = 0
for key, count in sorted(counter.items(), key=_itemgetter(1), reverse=True):
sum_ += count
print("{1:6d}x DXFType: {0}".format(key, count))
print("Overall sum: {0}".format(sum_))
def create_struct_class(field_names):
# type: (Iterable[str]) -> Type
field_names = tuple(field_names)
struct_class = _CLASS_CACHE.get(field_names)
if struct_class:
return struct_class
# Variables used in the methods and docstrings
for name in field_names:
if not all(c.isalnum() or c == "_" for c in name):
raise ValueError(
"Field names can only contain alphanumeric characters and underscores: %r"
% name
)
if _iskeyword(name):
raise ValueError("Field names cannot be a keyword: %r" % name)
if name[0].isdigit():
raise ValueError("Field names cannot start with a number: %r" % name)
arg_list = repr(field_names).replace("'", "")[1:-1]
tuple_new = tuple.__new__
# Create all the named tuple methods to be added to the class namespace
s = (
"def __new__(_cls, "
+ arg_list
+ "): return _tuple_new(_cls, ("
+ arg_list
+ "))"
)
namespace = {"_tuple_new": tuple_new, "__name__": _TYPENAME}
# Note: exec() has the side-effect of interning the field names
exec(s, namespace)
__new__ = namespace["__new__"]
# Build-up the class namespace dictionary
# and use type() to build the result class
class_namespace = {
"__slots__": (),
"_fields": field_names,
"__new__": __new__,
"__repr__": _create_struct_repr(field_names),
"_asdict": _asdict,
"to_json": _to_json,
}
cache = _nt_itemgetters
for index, name in enumerate(field_names):
try:
itemgetter_object = cache[index]
except KeyError:
itemgetter_object = _itemgetter(index)
cache[index] = itemgetter_object
class_namespace[name] = property(itemgetter_object)
struct_class = type(_TYPENAME, (tuple,), class_namespace)
_CLASS_CACHE[field_names] = struct_class
return struct_class
def __new__(mcl, name, parents, dct):
if name == "TypedNamedTuple":
return super(TypedNamedTupleMeta,
mcl).__new__(mcl, name, parents, dct)
fields = []
for k, v in dct.items():
if k.startswith("_"):
continue
if isinstance(v, TProp):
fields.append((k,) + v)
if fields:
fields = sorted(fields, key=lambda f: f[1])
field_names = tuple(f[0] for f in fields)
new_dct = {k: v for k, v in dct.items() if k not in field_names}
if fields:
new_dct["_fields"] = field_names
types = {}
for field_name, idx in zip(field_names, range(len(field_names))):
new_dct[field_name] = property(_itemgetter(idx),
doc='Alias for field number %d' % idx)
types[field_name] = fields[idx][2]
new_dct["_types"] = types
# Make vars() work on result
new_dct["__dict__"] = property(parents[0]._asdict)
ret = super(TypedNamedTupleMeta,
mcl).__new__(mcl, name, parents, new_dct)
return ret
def namedtuple(typename, field_names, verbose=False):
"""Returns a new subclass of tuple with named fields.
>>> Point = namedtuple('Point', 'x y')
>>> Point.__doc__ # docstring for the new class
'Point(x, y)'
>>> p = Point(11, y=22) # instantiate with positional args or keywords
>>> p[0] + p[1] # indexable like a plain tuple
33
>>> x, y = p # unpack like a regular tuple
>>> x, y
(11, 22)
>>> p.x + p.y # fields also accessable by name
33
>>> d = p._asdict() # convert to a dictionary
>>> d['x']
11
>>> Point(**d) # convert from a dictionary
Point(x=11, y=22)
>>> p._replace(x=100) # _replace() is like str.replace() but targets named fields
Point(x=100, y=22)
"""
# Parse and validate the field names. Validation serves two purposes,
# generating informative error messages and preventing template injection attacks.
if isinstance(field_names, basestring):
# names separated by whitespace and/or commas
field_names = field_names.replace(',', ' ').split()
field_names = list(field_names)
seen_names = set()
for name in [typename] + field_names:
if not all(c.isalnum() or c=='_' for c in name):
raise ValueError('Names can only contain alphanumeric characters and underscores: %r' % name)
if _iskeyword(name):
raise ValueError('Encountered duplicate field name: %r' % name)
if name[0].isdigit():
raise ValueError('Type names and field names cannot start with a number: %r' % name)
seen_names.add(name)
name_to_field = dict((v, idx) for idx, v in (enumerate(field_names)))
attributes = {'_field_names' : name_to_field,
'_fields' : tuple(field_names),
# immutable and we need it often
'_field_len' : len(field_names),
'__slots__' : (),
'__doc__': "%s(%s)" % (typename, ', '.join(field_names))}
# create properties
for attr, idx in name_to_field.iteritems():
attributes[attr] = property(_itemgetter(idx))
if verbose:
print attributes
# create the new class, deriving from _NamedTuple
result = type(typename, (_NamedTuple,), attributes)
# For pickling to work, the __module__ variable needs to be set to the frame
# where the named tuple is created. Bypass this step in enviroments where
# sys._getframe is not defined (Jython for example).
if hasattr(_sys, '_getframe'):
result.__module__ = _sys._getframe(1).f_globals.get('__name__', '__main__')
return result
class Character(tuple):
"""Character(name, owner, description, level, team, meta)"""
__slots__ = ()
_fields = ('name', 'owner', 'description', 'level', 'team', 'meta',
'ustats')
def __new__(_cls,
name,
owner,
description,
level,
team,
meta,
ustats=None):
'Create new instance of Character(name, owner, description, level, team, meta)'
if ustats is None:
ustats = {}
return _tuple.__new__(
_cls, (name, owner, description, level, team, meta, ustats))
@classmethod
def _make(cls, iterable, new=tuple.__new__, len=len):
"""Make a new Character object from a sequence or iterable"""
result = new(cls, iterable)
if len(result) != 6:
raise TypeError('Expected 6 arguments, got %d' % len(result))
return result
def _replace(_self, **kwds):
"""Return a new Character object replacing specified fields with new values"""
result = _self._make(
map(kwds.pop,
('name', 'owner', 'description', 'level', 'team', 'meta'),
_self))
if kwds:
raise ValueError('Got unexpected field names: %r' % list(kwds))
return result
def __repr__(self):
'Return a nicely formatted representation string'
return self.__class__.__name__ + '(name=%r, owner=%r, description=%r, level=%r, team=%r, meta=%r, ustats=%r)' % self
def _asdict(self):
'Return a new OrderedDict which maps field names to their values.'
return OrderedDict(zip(self._fields, self))
def __getnewargs__(self):
'Return self as a plain tuple. Used by copy and pickle.'
return tuple(self)
name = _property(_itemgetter(0), doc='Alias for field number 0')
owner = _property(_itemgetter(1), doc='Alias for field number 1')
description = _property(_itemgetter(2), doc='Alias for field number 2')
level = _property(_itemgetter(3), doc='Alias for field number 3')
team = _property(_itemgetter(4), doc='Alias for field number 4')
meta = _property(_itemgetter(5), doc='Alias for field number 5')
ustats = _property(_itemgetter(6), doc='Alias for field number 6')
def transform_theory_atom(x):
"""
Transforms the given theory atom.
"""
atoms = []
atom = TheoryAtomTransformer(atoms)(x)
# maps atoms to a set of numeric ranges
numeric = {}
# maps ranges to a set of symbolic ranges
other = {}
# add to symbolic ranges converting numeric ranges
def add(atm, lhs, rhs):
if isinstance(lhs, _Number):
lhs = _ast.SymbolicTerm(atom.location, _clingo.Number(lhs))
if rhs == float("inf"):
rhs = _ast.SymbolicTerm(atom.location, _clingo.Supremum)
elif isinstance(rhs, _Number):
rhs = _ast.SymbolicTerm(atom.location, _clingo.Number(rhs))
rng = (lhs, rhs)
other.setdefault(rng, (rng, {}))[1].setdefault(atm, atm)
# split into numeric and symbolic ranges
for atm, (lhs, rhs) in atoms:
if isinstance(lhs, _Number) and isinstance(rhs, _Number):
numeric.setdefault(atm, (atm, IntervalSet()))[1].add((lhs, rhs+1))
else:
add(atm, lhs, rhs)
# add combined numeric ranges as symbolic ranges
for atm, rngs in numeric.values():
for lhs, rhs in rngs:
add(atm, lhs, rhs-1)
# flatten symbolic ranges into a list
ranges = []
for _, (rng, atoms) in sorted(other.items(), key=_itemgetter(0)):
ranges.append((rng, [atm for _, atm in sorted(atoms.items(), key=_itemgetter(0))]))
return atom, ranges
def _get_dataruns(self):
'''Returns a list of dataruns, in order.
'''
if self._data_runs is None:
raise DataStreamError("Resident datastream don't have dataruns")
if not self._data_runs_sorted:
self._data_runs.sort(key=_itemgetter(0))
self._data_runs_sorted = True
return [data[1] for data in self._data_runs]
class Point(tuple):
'Point(x, y)'
__slots__ = ()
_fields = ('x', 'y')
def __new__(_cls, x, y):
'Create new instance of Point(x, y)'
return _tuple.__new__(_cls, (x, y))
@classmethod
def _make(cls, iterable, new=tuple.__new__, len=len):
'Make a new Point object from a sequence or iterable'
result = new(cls, iterable)
if len(result) != 2:
raise TypeError('Expected 2 arguments, got %d' % len(result))
return result
def _replace(_self, **kwds):
'Return a new Point object replacing specified fields with new values'
result = _self._make(map(kwds.pop, ('x', 'y'), _self))
if kwds:
raise ValueError('Got unexpected field names: %r' % list(kwds))
return result
def __repr__(self):
'Return a nicely formatted representation string'
return self.__class__.__name__ + '(x=%r, y=%r)' % self
def _asdict(self):
'Return a new OrderedDict which maps field names to their values.'
return OrderedDict(zip(self._fields, self))
def __getnewargs__(self):
'Return self as a plain tuple. Used by copy and pickle.'
return tuple(self)
x = _property(_itemgetter(0), doc='Alias for field number 0')
y = _property(_itemgetter(1), doc='Alias for field number 1')
class PositionalSpec(tuple):
"""
Encapsulates the parse specification for a positional argument group.
NOTE(josh): this is a named tuple with default arguments and some init
processing. If it wasn't for the init processing, we could just do:
PositionalSpec = collections.namedtuple(
"PositionalSpec", ["nargs", ...])
PositionalSpec.__new__.__defaults__ = (False, None, None, False)
But we don't want to self.tags and self.flags to point to a mutable global
variable...
"""
def __new__(cls, nargs, sortable=False, tags=None, flags=None, legacy=False):
if not tags:
tags = []
if not flags:
flags = []
return tuple.__new__(cls, (nargs, sortable, tags, flags, legacy))
nargs = property(_itemgetter(0))
npargs = property(_itemgetter(0))
sortable = property(_itemgetter(1))
tags = property(_itemgetter(2))
flags = property(_itemgetter(3))
legacy = property(_itemgetter(4))
class PositionalSpec(tuple):
"""
Encapsulates the parse specification for a positional argument group.
NOTE(josh): this is a named tuple with default arguments and some init
processing. If it wasn't for the init processing, we could just do:
PositionalSpec = collections.namedtuple(
"PositionalSpec", ["nargs", ...])
PositionalSpec.__new__.__defaults__ = (False, None, None, False)
But we don't want to self.tags and self.flags to point to a mutable global
variable...
"""
def __new__(cls,
nargs,
sortable=False,
tags=None,
flags=None,
legacy=False,
max_pargs_hwrap=None,
always_wrap=None):
if not tags:
tags = []
if not flags:
flags = []
return tuple.__new__(cls, (nargs, sortable, tags, flags, legacy,
max_pargs_hwrap, always_wrap))
nargs = property(_itemgetter(0))
npargs = property(_itemgetter(0))
sortable = property(_itemgetter(1))
tags = property(_itemgetter(2))
flags = property(_itemgetter(3))
legacy = property(_itemgetter(4))
max_pargs_hwrap = property(_itemgetter(5))
always_wrap = property(_itemgetter(6))
def replace(self, **kwargs):
selfdict = {
"nargs": self.nargs,
"sortable": self.sortable,
"tags": list(self.tags),
"flags": list(self.flags),
"legacy": self.legacy,
"max_pargs_hwrap": self.max_pargs_hwrap,
"always_wrap": self.always_wrap
}
selfdict.update(kwargs)
return PositionalSpec(**selfdict)
class TreeChangeTuple(tuple):
'TreeChangeTuple(type, old, new)'
__slots__ = ()
_fields = ('type', 'old', 'new')
def __new__(_cls, type, old, new):
return _tuple.__new__(_cls, (type, old, new))
@classmethod
def _make(cls, iterable, new=tuple.__new__, len=len):
'Make a new TreeChangeTuple object from a sequence or iterable'
result = new(cls, iterable)
if len(result) != 3:
raise TypeError('Expected 3 arguments, got %d' % len(result))
return result
def __repr__(self):
return 'TreeChangeTuple(type=%r, old=%r, new=%r)' % self
def _asdict(t):
'Return a new dict which maps field names to their values'
return {'type': t[0], 'old': t[1], 'new': t[2]}
def _replace(_self, **kwds):
'Return a new TreeChangeTuple object replacing specified fields with new values'
result = _self._make(map(kwds.pop, ('type', 'old', 'new'), _self))
if kwds:
raise ValueError('Got unexpected field names: %r' %
kwds.keys())
return result
def __getnewargs__(self):
return tuple(self)
type = _property(_itemgetter(0))
old = _property(_itemgetter(1))
new = _property(_itemgetter(2))
def get_score(cards): main = None values = list(get_values(cards)) while 1 in values: values.remove(1) values.append(14) if is_royal_flush(cards): main = 9 values = [14, 13, 12, 11, 10] elif is_straight_flush(cards): main = 8 if 1 in cards and 2 in cards: values.remove(14) values.append(1) values = sorted(values, reverse=True) elif is_four_of_a_kind(cards): main = 7 values = list(_chain.from_iterable(map(lambda item: [item[0]] * item[1], sorted(_Counter(values).items(), key=_itemgetter(1), reverse=True)))) elif is_full_house(cards): main = 6 values = list(_chain.from_iterable(map(lambda item: [item[0]] * item[1], sorted(_Counter(values).items(), key=_itemgetter(1), reverse=True)))) elif is_flush(cards): main = 5 values = sorted(values, reverse=True) elif is_straight(cards): main = 4 if 1 in cards and 2 in cards: values.remove(14) values.append(1) values = sorted(values, reverse=True) elif is_three_of_a_kind(cards): main = 3 values = list(_chain.from_iterable(map(lambda item: [item[0]] * item[1], sorted(_Counter(values).items(), key=_itemgetter(1), reverse=True)))) if values[3] < values[4]: values[3], values[4] = values[4], values[3] elif is_two_pair(cards): main = 2 values = list(_chain.from_iterable(map(lambda item: [item[0]] * item[1], sorted(_Counter(values).items(), key=_itemgetter(1), reverse=True)))) if values[0] < values[2]: values[0:2], values[2:4] = values[2:4], values[0:2] elif is_one_pair(cards): main = 1 values = list(_chain.from_iterable(map(lambda item: [item[0]] * item[1], sorted(_Counter(values).items(), key=_itemgetter(1), reverse=True)))) high = max(tuple(enumerate(values))[2:], key=_itemgetter(1))[0] values[2], values[high] = values[high], values[2] if values[3] < values[4]: values[3], values[4] = values[4], values[3] else: main = 0 values = sorted(values, reverse=True) return [main] + values
def __new__(cls, *args, **kwargs):
if not len(args) + len(kwargs) == cls._field_len:
raise TypeError("Invalid number of arguments!")
arguments = list(args)
if kwargs:
def name_to_position(pair):
return cls._field_names[pair[0]]
try:
sorted_args = sorted(kwargs.iteritems(), key=name_to_position)
# sorted by key, but we only need the value
arguments.extend(_imap(_itemgetter(1), sorted_args))
except KeyError:
raise TypeError("Invalid arguments!")
return tuple.__new__(cls, arguments)
def _observation_picker(station, system="G"):
try:
system = _SYSTEM_NAME[system.upper()]
except KeyError:
raise Warning("Unknown Satellite System:", system,
"OPTIONS: G-R-E-C-J-R-I-S")
#-------------------------------------------------------------------
# RINEX-3
if station.version.startswith("3"):
observation_codes = station.observation.columns.tolist()
system_observations = getattr(station.observation_types, system)
band_list = set("L" + code[1] for code in observation_codes
if len(code) == 3)
channel_list = set(
[code[2] for code in observation_codes if len(code) == 3])
obs_codes = []
for band in band_list:
if band in _SYSTEM_RNX3[system]:
for channel in channel_list:
if (band + channel
) in _SYSTEM_RNX3[system][band]["Carrierphase"] and (
band + channel) in system_observations:
obs_codes.append([
system, band, (band + channel),
("C" + band[1] + channel),
_SYSTEM_RNX3[system][band]["Frequency"]
])
break
# RINEX-2
elif station.version.startswith("2"):
observation_codes = station.observation.columns.tolist()
system_observations = station.observation_types
band_list = set(code for code in observation_codes
if code.startswith(("L")))
obs_codes = []
for band in band_list:
if band in _SYSTEM_RNX2[system].keys():
for code in _SYSTEM_RNX2[system][band]["Pseudorange"]:
if code in system_observations:
obs_codes.append([
system, band, band, code,
_SYSTEM_RNX2[system][band]["Frequency"]
])
break
obs_codes = sorted(obs_codes, key=_itemgetter(1))
return (obs_codes[0], obs_codes[1])
def less_than(self,maxvalue,ret='list'):
temp = sorted(self.items(),key=_itemgetter(1))
low = 0
high = temp.__len__()
while ((high-low) > 1):
mid = (low+high) >> 1
if temp[mid][1] <= maxvalue:
low = mid
else:
high = mid
if temp[low][1]>maxvalue:
if ret=='dict':
return {}
else:
return []
if ret=='dict':
ret_data = {}
for ele,count in temp[:high]:
ret_data[ele]=count
return ret_data
else:
return temp[:high]
def less_than(self,maxvalue,ret='list'):
temp = sorted(self.items(),key=_itemgetter(1))
low = 0
high = temp.__len__()
while ((high-low) > 1):
mid = (low+high) >> 1
if temp[mid][1] <= maxvalue:
low = mid
else:
high = mid
if temp[low][1]>maxvalue:
if ret=='dict':
return {}
else:
return []
if ret=='dict':
ret_data = {}
for ele,count in temp[:high]:
ret_data[ele]=count
return ret_data
else:
return temp[:high]
def larger_than(self, minvalue, ret='list'):
temp = sorted(self.items(), key=_itemgetter(1), reverse=True)
low = 0
high = temp.__len__()
while high - low > 1:
mid = (low + high) >> 1
if temp[mid][1] >= minvalue:
low = mid
else:
high = mid
if temp[low][1] < minvalue:
if ret == 'dict':
return {}
else:
return []
if ret == 'dict':
ret_data = {}
for ele, count in temp[:high]:
ret_data[ele] = count
return ret_data
else:
return temp[:high]
@classmethod
def _make(cls, iterable, new=tuple.__new__, len=len):
'Make a new TIPO object from a sequence or iterable'
result = new(cls, iterable)
if len(result) != 1:
raise TypeError('Expected 1 arguments, got %d' % len(result))
return result
def _replace(_self, **kwds):
'Return a new TIPO object replacing specified fields with new values'
result = _self._make(map(kwds.pop, ('VALOR',), _self))
if kwds:
raise ValueError('Got unexpected field names: %r' % list(kwds))
return result
def __repr__(self):
'Return a nicely formatted representation string'
return self.__class__.__name__ + '(VALOR=%r)' % self
def _asdict(self):
'Return a new OrderedDict which maps field names to their values.'
return OrderedDict(zip(self._fields, self))
def __getnewargs__(self):
'Return self as a plain tuple. Used by copy and pickle.'
return tuple(self)
VALOR = _property(_itemgetter(0), doc='Alias for field number 0')
def create_struct_class(field_names):
# type: (Iterable[str]) -> Type
field_names = tuple(field_names)
struct_class = _CLASS_CACHE.get(field_names)
if struct_class:
return struct_class
# Variables used in the methods and docstrings
for name in field_names:
if not all(c.isalnum() or c == "_" for c in name):
raise ValueError(
"Field names can only contain alphanumeric characters and underscores: %r"
% name
)
if _iskeyword(name):
raise ValueError("Field names cannot be a keyword: %r" % name)
if name[0].isdigit():
raise ValueError("Field names cannot start with a number: %r" % name)
arg_list = repr(field_names).replace("'", "")[1:-1]
repr_fmt = "(" + ", ".join(name + "=%r" for name in field_names) + ")"
tuple_new = tuple.__new__
# Create all the named tuple methods to be added to the class namespace
s = (
"def __new__(_cls, "
+ arg_list
+ "): return _tuple_new(_cls, ("
+ arg_list
+ "))"
)
namespace = {"_tuple_new": tuple_new, "__name__": _TYPENAME}
# Note: exec() has the side-effect of interning the field names
exec s in namespace
__new__ = namespace["__new__"]
def __repr__(self):
"""Return a nicely formatted representation string"""
return self.__class__.__name__ + repr_fmt % self
def _asdict(self):
"""Return a new OrderedDict which maps field names to their values."""
return OrderedDict(zip(self._fields, self))
def to_json(self):
"""Creates a JSON string representation of this struct instance."""
return json.dumps(
self, cls=StructEncoder, separators=(",", ":"), sort_keys=True
)
# Build-up the class namespace dictionary
# and use type() to build the result class
class_namespace = {
"__slots__": (),
"_fields": field_names,
"__new__": __new__,
"__repr__": __repr__,
"_asdict": _asdict,
"to_json": to_json,
}
cache = _nt_itemgetters
for index, name in enumerate(field_names):
try:
itemgetter_object = cache[index]
except KeyError:
itemgetter_object = _itemgetter(index)
cache[index] = itemgetter_object
class_namespace[name] = property(itemgetter_object)
struct_class = type(_TYPENAME, (tuple,), class_namespace)
_CLASS_CACHE[field_names] = struct_class
return struct_class
def most_common(self, n = None):
if n is None:
return sorted(self.iteritems(), key=_itemgetter(1), reverse=True)
return _heapq.nlargest(n, self.iteritems(), key=_itemgetter(1))
def Harmonize(tonic, scale, interval, non_harmonic='below'):
"""
A diatonic harmonizer.
:param tonic:
The tonic of the scale, as a note name.
:param scale:
The type/mode, of the scale, one of:
``'major'``, ``'minor'``, ``'minor_harmonic'``, ``'ionian'``,
``'dorian'``, ``'phrygian'``, ``'lydian'``, ``'mixolydian'``,
``'aeolian'``, ``'locrian'``.
:param interval:
The number of steps to transpose the notes by
(as an integer), or one of these interval names:
``'unison'``, ``'second'``, ``'third'``, ``'fourth'``, ``'fifth'``,
``'sixth'``, ``'seventh'``, ``'octave'``, ``'ninth'``, ``'tenth'``,
``'eleventh'``, ``'twelfth'``, ``'thirteenth'``.
It is also possible to pass a list of intervals, to create
multiple harmonized voices.
:param non_harmonic: What to do with out-of-scale notes:
- ``'below'``: Transpose by the same interval as the next on-scale
- ``'above'``: Transpose by the same interval as the next on-scale
- ``'skip'``: Ignore note.
- ``'same'``: Output note as is, without transposing it.
"""
t = _util.tonic_note_number(tonic)
if _misc.issequence(scale):
shift = 0
elif isinstance(scale, str):
if scale == 'major':
scale = _MAJOR_SCALE
shift = 0
elif scale == 'minor':
scale = _MAJOR_SCALE
shift = 5
elif scale == 'minor_harmonic':
scale = _HARMONIC_MINOR_SCALE
shift = 0
elif scale in _MODES:
shift = _MODES.index(scale)
scale = _MAJOR_SCALE
# shift scale to the correct mode
s = ([x - scale[shift] for x in scale[shift:]] +
[x + 12 - scale[shift] for x in scale[:shift]])
if not _misc.issequence(interval):
interval = [interval]
# convert all interval names to numbers
iv = [(_INTERVALS.index(x) if x in _INTERVALS else x) for x in interval]
# python version:
# f = [ _m.Process(_Harmonizer(t, s, i, non_harmonic)) for i in iv ]
# pure mididings version:
f = []
for i in iv:
h = _Harmonizer(t, s, i, non_harmonic)
# get offset for each key
offsets = [(x, h.note_offset(x)) for x in range(128)]
# group by offset
groups = _itertools.groupby(sorted(offsets, key=_itemgetter(1)),
key=_itemgetter(1))
# create one KeyFilter()/Transpose() pair for each offset
for off, keys in groups:
if off is not None:
f.append(_m.KeyFilter(notes=[k[0] for k in keys]) >>
_m.Transpose(off))
return _m.Filter(_m.NOTE) % f
def namedtuple(typename,
field_names,
*,
rename=False,
defaults=None,
module=None):
"""Returns a new subclass of tuple with named fields.
>>> Point = namedtuple('Point', ['x', 'y'])
>>> Point.__doc__ # docstring for the new class
'Point(x, y)'
>>> p = Point(11, y=22) # instantiate with positional args or keywords
>>> p[0] + p[1] # indexable like a plain tuple
33
>>> x, y = p # unpack like a regular tuple
>>> x, y
(11, 22)
>>> p.x + p.y # fields also accessible by name
33
>>> d = p._asdict() # convert to a dictionary
>>> d['x']
11
>>> Point(**d) # convert from a dictionary
Point(x=11, y=22)
>>> p._replace(x=100) # _replace() is like str.replace() but targets named fields
Point(x=100, y=22)
"""
# Validate the field names. At the user's option, either generate an error
# message or automatically replace the field name with a valid name.
if isinstance(field_names, str):
field_names = field_names.replace(',', ' ').split()
field_names = list(map(str, field_names))
typename = _sys.intern(str(typename))
if rename:
seen = set()
for index, name in enumerate(field_names):
if (not name.isidentifier() or _iskeyword(name)
or name.startswith('_') or name in seen):
field_names[index] = f'_{index}'
seen.add(name)
for name in [typename] + field_names:
if type(name) is not str:
raise TypeError('Type names and field names must be strings')
if not name.isidentifier():
raise ValueError('Type names and field names must be valid '
f'identifiers: {name!r}')
if _iskeyword(name):
raise ValueError('Type names and field names cannot be a '
f'keyword: {name!r}')
seen = set()
for name in field_names:
if name.startswith('_') and not rename:
raise ValueError('Field names cannot start with an underscore: '
f'{name!r}')
if name in seen:
raise ValueError(f'Encountered duplicate field name: {name!r}')
seen.add(name)
field_defaults = {}
if defaults is not None:
defaults = tuple(defaults)
if len(defaults) > len(field_names):
raise TypeError('Got more default values than field names')
field_defaults = dict(
reversed(list(zip(reversed(field_names), reversed(defaults)))))
# Variables used in the methods and docstrings
field_names = tuple(map(_sys.intern, field_names))
num_fields = len(field_names)
arg_list = repr(field_names).replace("'", "")[1:-1]
repr_fmt = '(' + ', '.join(f'{name}=%r' for name in field_names) + ')'
tuple_new = tuple.__new__
_len = len
# Create all the named tuple methods to be added to the class namespace
s = f'def __new__(_cls, {arg_list}): return _tuple_new(_cls, ({arg_list}))'
namespace = {'_tuple_new': tuple_new, '__name__': f'namedtuple_{typename}'}
# Note: exec() has the side-effect of interning the field names
exec(s, namespace)
__new__ = namespace['__new__']
__new__.__doc__ = f'Create new instance of {typename}({arg_list})'
if defaults is not None:
__new__.__defaults__ = defaults
@classmethod
def _make(cls, iterable):
result = tuple_new(cls, iterable)
if _len(result) != num_fields:
raise TypeError(
f'Expected {num_fields} arguments, got {len(result)}')
return result
_make.__func__.__doc__ = (f'Make a new {typename} object from a sequence '
'or iterable')
def _replace(_self, **kwds):
result = _self._make(map(kwds.pop, field_names, _self))
if kwds:
raise ValueError(f'Got unexpected field names: {list(kwds)!r}')
return result
_replace.__doc__ = (f'Return a new {typename} object replacing specified '
'fields with new values')
def __repr__(self):
'Return a nicely formatted representation string'
return self.__class__.__name__ + repr_fmt % self
def _asdict(self):
'Return a new OrderedDict which maps field names to their values.'
return OrderedDict(zip(self._fields, self))
def __getnewargs__(self):
'Return self as a plain tuple. Used by copy and pickle.'
return tuple(self)
# Modify function metadata to help with introspection and debugging
for method in (__new__, _make.__func__, _replace, __repr__, _asdict,
__getnewargs__):
method.__qualname__ = f'{typename}.{method.__name__}'
# Build-up the class namespace dictionary
# and use type() to build the result class
class_namespace = {
'__doc__': f'{typename}({arg_list})',
'__slots__': (),
'_fields': field_names,
'_fields_defaults': field_defaults,
'__new__': __new__,
'_make': _make,
'_replace': _replace,
'__repr__': __repr__,
'_asdict': _asdict,
'__getnewargs__': __getnewargs__,
}
cache = _nt_itemgetters
for index, name in enumerate(field_names):
try:
itemgetter_object, doc = cache[index]
except KeyError:
itemgetter_object = _itemgetter(index)
doc = f'Alias for field number {index}'
cache[index] = itemgetter_object, doc
class_namespace[name] = property(itemgetter_object, doc=doc)
result = type(typename, (tuple, ), class_namespace)
# For pickling to work, the __module__ variable needs to be set to the frame
# where the named tuple is created. Bypass this step in environments where
# sys._getframe is not defined (Jython for example) or sys._getframe is not
# defined for arguments greater than 0 (IronPython), or where the user has
# specified a particular module.
if module is None:
try:
module = _sys._getframe(1).f_globals.get('__name__', '__main__')
except (AttributeError, ValueError):
pass
if module is not None:
result.__module__ = module
return result
def from_prototxt(text=None, filename=None):
r"""
Create an :py:class:`NetSpecification` object from a text spec.
Either ``text`` or ``filename`` may be set, and is accordingly used.
Files may be of any caffe prototxt version.
"""
# Check if the user erroneously specified a filename as text.
if text is not None:
if _os.linesep not in text:
if _os.path.exists(text):
_LOGGER.warn('You probably mistakenly specified a filename '
'as text: "%s"! Trying to recover...', text)
filename = text
text = None
if filename is not None:
assert text is None
# Do a conversion if necessary.
with _NamedTemporaryFile(mode='r', suffix='.prototxt') as tmpfile:
net_upgrader_exec = _os.path.join(_CAFFE_BIN_FOLDER,
'upgrade_net_proto_text')
assert _os.path.exists(net_upgrader_exec),\
("The executable 'upgrade_net_proto_text' was not found "
"in your _CAFFE_BIN_FOLDER! Please set it from the "
"module `barrista.config`. The current folder is set "
"to: " + _CAFFE_BIN_FOLDER + ".")
_subprocess.check_call([net_upgrader_exec,
filename,
tmpfile.name])
text = tmpfile.read()
message = _caffe_pb2.NetParameter()
_gprototext.Merge(text, message)
# Check for completeness of the parsing process.
fields = message.ListFields()
for fielddesc in map(_itemgetter(0), fields): # pylint: disable=W0141
if fielddesc.name not in ['name',
'input_shape',
'debug_info',
'input',
'input_dim',
'layer',
'force_backward',
'state']:
_LOGGER.warn('Parsed net prototxt contained unknown field ' +
fielddesc.name + '. Ignored.')
if len(message.input_dim) > 0:
_LOGGER.warn('The loaded prototxt contains `input_dim` fields. '
'They are deprecated! Use `input_shape` instead.')
if _HAS_BLOB_SHAPE:
assert len(message.input_shape) == 0
assert len(message.input_dim) % 4 == 0
input_shape = _copy.deepcopy(list(_chunks(message.input_dim, 4)))
else:
input_shape = _copy.deepcopy([bshape.dim for
bshape in message.input_shape])
inputs = _copy.deepcopy(message.input)
layerspecs = [LayerSpecification.from_pbuf_message(layer)
for layer in message.layer]
pbforcebw = message.force_backward
phase = message.state.phase
level = message.state.level
stages = _copy.deepcopy(message.state.stage)
debug_info = message.debug_info
name = message.name
spec = NetSpecification(input_shape,
inputs,
layerspecs,
pbforcebw,
phase,
level,
stages,
debug_info,
name)
return spec
class VersionInfo(tuple):
'''
Version number. This is a variation on a `namedtuple`.
Example:
VersionInfo(1, 2, 0) == \
VersionInfo(major=1, minor=2, micro=0, modifier='release') == \
(1, 2, 0)
'''
__slots__ = ()
_fields = ('major', 'minor', 'micro', 'modifier')
def __new__(cls, major, minor=0, micro=0, modifier='release'):
'''
Create new instance of `VersionInfo(major, minor, micro, modifier)`.
'''
assert isinstance(major, int)
assert isinstance(minor, int)
assert isinstance(micro, int)
assert isinstance(modifier, basestring)
return tuple.__new__(cls, (major, minor, micro, modifier))
@classmethod
def _make(cls, iterable, new=tuple.__new__, len=len):
'''Make a new `VersionInfo` object from a sequence or iterable.'''
result = new(cls, iterable)
if len(result) != 4:
raise TypeError('Expected 4 arguments, got %d' % len(result))
return result
def __repr__(self):
'''Return a nicely formatted representation string.'''
return 'VersionInfo(major=%r, minor=%r, micro=%r, modifier=%r)' % self
def _asdict(self):
'''
Return a new `OrderedDict` which maps field names to their values.
'''
from python_toolbox.nifty_collections import OrderedDict
return OrderedDict(zip(self._fields, self))
def _replace(self, **kwargs):
'''
Make a `VersionInfo` object replacing specified fields with new values.
'''
result = \
self._make(map(kwargs.pop, ('major', 'minor', 'micro', 'modifier'),
self))
if kwargs:
raise ValueError('Got unexpected field names: %r' % kwargs.keys())
return result
def __getnewargs__(self):
'''Return self as a plain tuple. Used by copy and pickle.'''
return tuple(self)
@property
def version_text(self):
'''A textual description of the version, like '1.4.2 beta'.'''
version_text = '%s.%s.%s' % (self.major, self.minor, self.micro)
if self.modifier != 'release':
version_text += ' %s' % self.modifier
return version_text
major = property(_itemgetter(0))
minor = property(_itemgetter(1))
micro = property(_itemgetter(2))
modifier = property(_itemgetter(3))
def most_common(self, n=None):
"""list the n most common elements and their counts from the most common
to the least. If n is None , then list all element counts"""
if n is None:
return sorted(self.iteritems(), key=_itemgetter(1), reverse=True)
def from_prototxt(text=None, filename=None):
r"""
Create an :py:class:`NetSpecification` object from a text spec.
Either ``text`` or ``filename`` may be set, and is accordingly used.
Files may be of any caffe prototxt version.
"""
# Check if the user erroneously specified a filename as text.
if text is not None:
if _os.linesep not in text:
if _os.path.exists(text): # pragma: no cover
_LOGGER.warn(
'You probably mistakenly specified a filename '
'as text: "%s"! Trying to recover...', text)
filename = text
text = None
if filename is not None:
assert text is None
# Do a conversion if necessary.
with _NamedTemporaryFile(mode='r', suffix='.prototxt') as tmpfile:
net_upgrader_exec = _os.path.join(_CAFFE_BIN_FOLDER,
'upgrade_net_proto_text')
assert _os.path.exists(net_upgrader_exec),\
("The executable 'upgrade_net_proto_text' was not found "
"in your _CAFFE_BIN_FOLDER! Please set it from the "
"module `barrista.config`. The current folder is set "
"to: " + _CAFFE_BIN_FOLDER + ".")
_subprocess.check_call(
[net_upgrader_exec, filename, tmpfile.name])
text = tmpfile.read()
message = _caffe_pb2.NetParameter()
_gprototext.Merge(text, message)
# Check for completeness of the parsing process.
fields = message.ListFields()
for fielddesc in map(_itemgetter(0), fields): # pylint: disable=W0141
if fielddesc.name not in [
'name', 'input_shape', 'debug_info', 'input', 'input_dim',
'layer', 'force_backward', 'state'
]:
_LOGGER.warn('Parsed net prototxt contained unknown field ' +
fielddesc.name + '. Ignored.')
if len(message.input_dim) > 0:
_LOGGER.warn('The loaded prototxt contains `input_dim` fields. '
'They are deprecated! Use `input_shape` instead.')
if _HAS_BLOB_SHAPE:
assert len(message.input_shape) == 0
assert len(message.input_dim) % 4 == 0
input_shape = _copy.deepcopy(list(_chunks(message.input_dim, 4)))
else: # pragma: no cover
input_shape = _copy.deepcopy(
[bshape.dim for bshape in message.input_shape])
inputs = _copy.deepcopy(message.input)
layerspecs = [
LayerSpecification.from_pbuf_message(layer)
for layer in message.layer
]
pbforcebw = message.force_backward
phase = message.state.phase
level = message.state.level
stages = _copy.deepcopy(message.state.stage)
debug_info = message.debug_info
name = message.name
spec = NetSpecification(input_shape, inputs, layerspecs, pbforcebw,
phase, level, stages, debug_info, name)
return spec
def common_sub_strings(stringx: str, stringy: str, limit=25):
"""Finds all common substrings between stringx and stringy
longer than limit. This function is case sensitive.
The substrings may overlap.
returns a list of tuples describing the substrings
The list is sorted longest -> shortest.
Parameters
----------
stringx : str
stringy : str
limit : int, optional
Returns
-------
list of tuple
[(startx1,starty1,length1),(startx2,starty2,length2), ...]
startx1 = startposition in x, where substring 1 starts
starty1 = position in y where substring 1 starts
length1 = lenght of substring
Examples
--------
>>> from pydna.common_sub_strings import common_sub_strings
>>> common_sub_strings("gatgatttcggtagtta", "gtcagtatgtctatctatcgcg", limit=3)
[(1, 6, 3), (7, 17, 3), (10, 4, 3), (12, 3, 3)]
::
Overlaps Symbols
(1, 6, 3) ---
(7, 17, 3) +++
(10, 4, 3) ...
(12, 3, 3) ===
===
gatgatttcggtagtta stringx
--- +++...
...
gtcagtatgtctatctatcgcg stringy
===--- +++
"""
rstr = Rstr_max()
rstr.add_str(stringx + "&" + stringy)
r = rstr.go()
match = {} # _defaultdict(int)
for (offset_end, nb), (l, start_plage) in r.items():
startsx = []
startsy = []
if l < limit:
continue
for o in range(start_plage, start_plage + nb):
offset = rstr.idxPos[rstr.res[o]]
if offset > len(stringx):
startsy.append(offset - len(stringx) - 1)
else:
startsx.append(offset)
for a, b in _itertools.product(startsx, startsy):
match[(a, b)] = max(match.get((a, b)) or 0, l)
match = [(key[0], key[1], val) for key, val in list(match.items())]
match.sort()
match.sort(key=_itemgetter(2), reverse=True)
return match
def most_common(mydict, n=None):
if n is None:
return sorted(mydict.items(), key=_itemgetter(1), reverse=True)
return heapq.nlargest(n, mydict.items(), key=_itemgetter(1))
def most_common(self, n=None):
"""Return the `n` most common elements.
"""
if n is None:
return sorted(self.items(), key=_itemgetter(1), reverse=True)
return _heapq.nlargest(n, self.items(), key=_itemgetter(1))
def namedtuple(typename, field_names, verbose=False, rename=False):
"""Returns a new subclass of tuple with named fields.
>>> Point = namedtuple('Point', 'x y')
>>> Point.__doc__ # docstring for the new class
'Point(x, y)'
>>> p = Point(11, y=22) # instantiate with positional args or keywords
>>> p[0] + p[1] # indexable like a plain tuple
33
>>> x, y = p # unpack like a regular tuple
>>> x, y
(11, 22)
>>> p.x + p.y # fields also accessable by name
33
>>> d = p._asdict() # convert to a dictionary
>>> d['x']
11
>>> Point(**d) # convert from a dictionary
Point(x=11, y=22)
>>> p._replace(x=100) # _replace() is like str.replace() but targets named fields
Point(x=100, y=22)
"""
if not isinstance(typename, basestring):
raise TypeError('typename must be a string, not %r' % type(typename))
err = _check_name(typename)
if err:
raise ValueError(err)
# Parse and validate the field names. Validation serves two purposes,
# generating informative error messages and preventing template
# injection attacks.
if isinstance(field_names, basestring):
# Field names separated by whitespace and/or commas.
field_names = field_names.replace(',', ' ').split()
field_names = list(map(str, field_names))
seen = set()
for i, name in enumerate(field_names):
err = _check_name(name)
if not err and name in seen:
err = "duplicate name '%s'" % name
if err:
if rename:
field_names[i] = "_%d" % i
else:
raise ValueError(err)
else:
seen.add(name)
field_names = tuple(field_names)
# === Dynamically construct the class ===
# Unlike Raymond Hettinger's original recipe found at
# http://code.activestate.com/recipes/500261-named-tuples/
# we use a regular nested class. The only method which needs to be
# generated dynamically is __new__.
numfields = len(field_names)
reprtxt = ', '.join('%s=%%r' % name for name in field_names)
argtxt = ', '.join(field_names)
class Inner(tuple):
# Work around for annoyance: type __doc__ is read-only :-(
__doc__ = ("%(typename)s(%(argtxt)s)"
% {'typename': typename, 'argtxt': argtxt})
__slots__ = ()
_fields = field_names
# Don't decorate with classmethod here. See below.
def _make(cls, iterable, new=tuple.__new__, len=len):
"""Make a new %s object from a sequence or iterable."""
result = new(cls, iterable)
if len(result) != numfields:
raise TypeError('Expected %d arguments, got %d' % (numfields, len(result)))
return result
# Work around for annoyance: classmethod __doc__ is read-only :-(
_make.__doc__ %= locals()
_make = classmethod(_make)
def __repr__(self):
return '%s(%s)' % (typename, reprtxt%self)
def _asdict(self):
"""Return a new dict which maps field names to their values."""
return dict(zip(self._fields, self))
def _replace(self, **kwds):
"""Return a new %(typename)s object replacing specified fields with new values."""
result = self._make(map(kwds.pop, self._fields, self))
#result = self._make(map(kwds.pop, ('x', 'y'), _self))
if kwds:
raise ValueError('Got unexpected field names: %r' % kwds.keys())
return result
def __getnewargs__(self):
return tuple(self)
# For pickling to work, the __module__ attribute needs to be set to the
# frame where the named tuple is created. Bypass this step in enviroments
# where sys._getframe is not defined (Jython for example) or sys._getframe
# is not defined for arguments greater than 0 (IronPython).
try:
Inner.__module__ = _sys._getframe(1).f_globals.get('__name__', '__main__')
except (AttributeError, ValueError):
pass
# Dynamically create the __new__ method and inject it into the class.
# We do this using exec because the method argument handling is otherwise
# too hard. The "cls" parameter is named _cls instead to avoid clashing
# with a field of that same name.
ns = {'_new': tuple.__new__}
template = """def __new__(_cls, %(argtxt)s):
return _new(_cls, (%(argtxt)s))""" % locals()
if verbose:
print template
exec template in ns, ns
Inner.__new__ = staticmethod(ns['__new__']) # NOT classmethod!
# Inject properties to retrieve items by name.
for i, name in enumerate(field_names):
setattr(Inner, name, property(_itemgetter(i)))
Inner.__dict__['_replace'].__doc__ %= locals()
Inner.__name__ = typename
return Inner
the_best = dict((x, y) for x, y in the_best)
cont = dict()
rows = []
total_songs_value = sum(total_songs.values())
with open('data/most_common_all_{}.csv'.format(pos_analysis), 'w') as f:
writer = csv.writer(f)
writer.writerow(["source", "target", "value"])
for year in total_most_common:
word_counter = total_most_common[year]
for tuple_w in word_counter:
term = tuple_w[0]
count = tuple_w[1]
if term in the_best:
if term not in cont:
cont[term] = {year: count}
else:
cont[term].update({year: count})
years_words = dict()
for w in cont:
index = 0
for year in cont[w]:
weight = cont[w][year]
row = [w, year, weight / float(count_songs[index]) * 100]
rows.append(row)
index += 1
sorted(rows, key=_itemgetter(1))
for r in rows:
writer.writerow(r)
def struct(**kwargs):
"""Creates an immutable container using the keyword arguments as attributes.
It can be used to group multiple values and/or functions together. Example:
def _my_function():
return 3
s = struct(x = 2, foo = _my_function)
return s.x + s.foo() # returns 5
The implementation is almost identical to namedtuple, but:
- it does not forbid fields starting with underscores
- does not implement methods for pickling
- does not support copy/deepcopy
"""
field_names = tuple(kwargs.keys())
for name in field_names:
if not all(c.isalnum() or c == "_" for c in name):
raise ValueError(
"Field names can only contain alphanumeric characters and underscores: %r"
% name)
if _iskeyword(name):
raise ValueError("Field names cannot be a keyword: %r" % name)
if name[0].isdigit():
raise ValueError("Field names cannot start with a number: %r" %
name)
# Variables used in the methods and docstrings
arg_list = repr(field_names).replace("'", "")[1:-1]
repr_fmt = "(" + ", ".join(name + "=%r" for name in field_names) + ")"
tuple_new = tuple.__new__
# Create all the named tuple methods to be added to the class namespace
s = ("def __new__(_cls, " + arg_list + "): return _tuple_new(_cls, (" +
arg_list + "))")
namespace = {"_tuple_new": tuple_new, "__name__": _TYPENAME}
# Note: exec() has the side-effect of interning the field names
exec s in namespace
__new__ = namespace["__new__"]
def __repr__(self):
"""Return a nicely formatted representation string"""
return self.__class__.__name__ + repr_fmt % self
def _asdict(self):
"""Return a new OrderedDict which maps field names to their values."""
return OrderedDict(zip(self._fields, self))
def to_json(self):
"""Creates a JSON string representation of this struct instance."""
return json.dumps(self,
cls=StructEncoder,
separators=(",", ":"),
sort_keys=True)
# Build-up the class namespace dictionary
# and use type() to build the result class
class_namespace = {
"__slots__": (),
"_fields": field_names,
"__new__": __new__,
"__repr__": __repr__,
"_asdict": _asdict,
"to_json": to_json,
}
cache = _nt_itemgetters
for index, name in enumerate(field_names):
try:
itemgetter_object = cache[index]
except KeyError:
itemgetter_object = _itemgetter(index)
cache[index] = itemgetter_object
class_namespace[name] = property(itemgetter_object)
result = type(_TYPENAME, (tuple, ), class_namespace)
return result(**kwargs)
def score_ngrams(self, score_fn):
"""Returns a sequence of (ngram, score) pairs ordered from highest to
lowest score, as determined by the scoring function provided.
"""
return sorted(self._score_ngrams(score_fn),
key=_itemgetter(1), reverse=True)
def namedtuple(typename, field_names, *, rename=False, defaults=None, module=None):
"""Returns a new subclass of tuple with named fields.
>>> Point = namedtuple('Point', ['x', 'y'])
>>> Point.__doc__ # docstring for the new class
'Point(x, y)'
>>> p = Point(11, y=22) # instantiate with positional args or keywords
>>> p[0] + p[1] # indexable like a plain tuple
33
>>> x, y = p # unpack like a regular tuple
>>> x, y
(11, 22)
>>> p.x + p.y # fields also accessible by name
33
>>> d = p._asdict() # convert to a dictionary
>>> d['x']
11
>>> Point(**d) # convert from a dictionary
Point(x=11, y=22)
>>> p._replace(x=100) # _replace() is like str.replace() but targets named fields
Point(x=100, y=22)
"""
# Validate the field names. At the user's option, either generate an error
# message or automatically replace the field name with a valid name.
if isinstance(field_names, str):
field_names = field_names.replace(',', ' ').split()
field_names = list(map(str, field_names))
typename = _sys.intern(str(typename))
if rename:
seen = set()
for index, name in enumerate(field_names):
if (not name.isidentifier()
or _iskeyword(name)
or name.startswith('_')
or name in seen):
field_names[index] = f'_{index}'
seen.add(name)
for name in [typename] + field_names:
if type(name) is not str:
raise TypeError('Type names and field names must be strings')
if not name.isidentifier():
raise ValueError('Type names and field names must be valid '
f'identifiers: {name!r}')
if _iskeyword(name):
raise ValueError('Type names and field names cannot be a '
f'keyword: {name!r}')
seen = set()
for name in field_names:
if name.startswith('_') and not rename:
raise ValueError('Field names cannot start with an underscore: '
f'{name!r}')
if name in seen:
raise ValueError(f'Encountered duplicate field name: {name!r}')
seen.add(name)
field_defaults = {}
if defaults is not None:
defaults = tuple(defaults)
if len(defaults) > len(field_names):
raise TypeError('Got more default values than field names')
field_defaults = dict(reversed(list(zip(reversed(field_names),
reversed(defaults)))))
# Variables used in the methods and docstrings
field_names = tuple(map(_sys.intern, field_names))
num_fields = len(field_names)
arg_list = repr(field_names).replace("'", "")[1:-1]
repr_fmt = '(' + ', '.join(f'{name}=%r' for name in field_names) + ')'
tuple_new = tuple.__new__
_len = len
# Create all the named tuple methods to be added to the class namespace
s = f'def __new__(_cls, {arg_list}): return _tuple_new(_cls, ({arg_list}))'
namespace = {'_tuple_new': tuple_new, '__name__': f'namedtuple_{typename}'}
# Note: exec() has the side-effect of interning the field names
exec(s, namespace)
__new__ = namespace['__new__']
__new__.__doc__ = f'Create new instance of {typename}({arg_list})'
if defaults is not None:
__new__.__defaults__ = defaults
@classmethod
def _make(cls, iterable):
result = tuple_new(cls, iterable)
if _len(result) != num_fields:
raise TypeError(f'Expected {num_fields} arguments, got {len(result)}')
return result
_make.__func__.__doc__ = (f'Make a new {typename} object from a sequence '
'or iterable')
def _replace(_self, **kwds):
result = _self._make(map(kwds.pop, field_names, _self))
if kwds:
raise ValueError(f'Got unexpected field names: {list(kwds)!r}')
return result
_replace.__doc__ = (f'Return a new {typename} object replacing specified '
'fields with new values')
def __repr__(self):
'Return a nicely formatted representation string'
return self.__class__.__name__ + repr_fmt % self
def _asdict(self):
'Return a new OrderedDict which maps field names to their values.'
return OrderedDict(zip(self._fields, self))
def __getnewargs__(self):
'Return self as a plain tuple. Used by copy and pickle.'
return tuple(self)
# Modify function metadata to help with introspection and debugging
for method in (__new__, _make.__func__, _replace,
__repr__, _asdict, __getnewargs__):
method.__qualname__ = f'{typename}.{method.__name__}'
# Build-up the class namespace dictionary
# and use type() to build the result class
class_namespace = {
'__doc__': f'{typename}({arg_list})',
'__slots__': (),
'_fields': field_names,
'_fields_defaults': field_defaults,
'__new__': __new__,
'_make': _make,
'_replace': _replace,
'__repr__': __repr__,
'_asdict': _asdict,
'__getnewargs__': __getnewargs__,
}
cache = _nt_itemgetters
for index, name in enumerate(field_names):
try:
itemgetter_object, doc = cache[index]
except KeyError:
itemgetter_object = _itemgetter(index)
doc = f'Alias for field number {index}'
cache[index] = itemgetter_object, doc
class_namespace[name] = property(itemgetter_object, doc=doc)
result = type(typename, (tuple,), class_namespace)
# For pickling to work, the __module__ variable needs to be set to the frame
# where the named tuple is created. Bypass this step in environments where
# sys._getframe is not defined (Jython for example) or sys._getframe is not
# defined for arguments greater than 0 (IronPython), or where the user has
# specified a particular module.
if module is None:
try:
module = _sys._getframe(1).f_globals.get('__name__', '__main__')
except (AttributeError, ValueError):
pass
if module is not None:
result.__module__ = module
return result
def __iter__(self):
c = self.conn.execute("SELECT key FROM Dict")
return map(_itemgetter(0), c.fetchall())
try:
from _collections import OrderedDict
except ImportError:
# Leave the pure Python version in place.
pass
################################################################################
### namedtuple
################################################################################
try:
from _collections import _tuplegetter
except ImportError:
_tuplegetter = lambda index, doc: property(_itemgetter(index), doc=doc)
def namedtuple(typename,
field_names,
*,
rename=False,
defaults=None,
module=None):
"""Returns a new subclass of tuple with named fields.
>>> Point = namedtuple('Point', ['x', 'y'])
>>> Point.__doc__ # docstring for the new class
'Point(x, y)'
>>> p = Point(11, y=22) # instantiate with positional args or keywords
>>> p[0] + p[1] # indexable like a plain tuple
class StatsTuple(tuple):
'''
tuple subclass used to track edit_distance and related values.
Copy-and-paste-and-modify of NamedTuple _source with
addition operator overridden
Attributes:
----------
edit_distance : int
num_deletions : int
num_insertions :int
num_substituions : int
num_ref_elements :int
'''
__slots__ = ()
_fields = ('edit_distance', 'num_deletions', 'num_insertions',
'num_substituions', 'num_ref_elements')
def __new__(_cls, edit_distance, num_deletions, num_insertions,
num_substituions, num_ref_elements):
'''Create new instance of DiffStats(edit_distance, num_deletions,
num_insertions, num_substituions, num_ref_elements, alignment)'''
return _tuple.__new__(_cls,
(edit_distance, num_deletions, num_insertions,
num_substituions, num_ref_elements))
@classmethod
def _make(cls, iterable, new=tuple.__new__, len=len):
'Make a new DiffStats object from a sequence or iterable'
result = new(cls, iterable)
if len(result) != 5:
raise TypeError('Expected 5 arguments, got %d' % len(result))
return result
def _replace(_self, **kwds):
'''Return a new StatsTuple object
replacing specified fields with new values'''
result = _self._make(
map(kwds.pop, ('edit_distance', 'num_deletions', 'num_insertions',
'num_substituions', 'num_ref_elements'), _self))
if kwds:
raise ValueError('Got unexpected field names: %r' % list(kwds))
return result
def __repr__(self):
'Return a nicely formatted representation string'
return self.__class__.__name__ + (
'(edit_distance=%r, num_deletions=%r, num_insertions=%r, '
'num_substituions=%r, num_ref_elements=%r)' % self)
def _asdict(self):
'Return a new OrderedDict which maps field names to their values.'
return OrderedDict(zip(self._fields, self))
def __getnewargs__(self):
'Return self as a plain tuple. Used by copy and pickle.'
return tuple(self)
def __add__(self, other):
'''
add all the attributes together and return a new StatsTuple object
'''
return StatsTuple(*(i + j for i, j in zip(self, other)))
edit_distance = _property(_itemgetter(0), doc='Alias for field number 0')
num_deletions = _property(_itemgetter(1), doc='Alias for field number 1')
num_insertions = _property(_itemgetter(2), doc='Alias for field number 2')
num_substituions = _property(_itemgetter(3),
doc='Alias for field number 3')
num_ref_elements = _property(_itemgetter(4),
doc='Alias for field number 4')
def most_common(self, n=None): return sorted(self.iteritems(), key=_itemgetter(1), reverse=True)
def score_ngrams(self, score_fn):
"""Returns a sequence of (ngram, score) pairs ordered from highest to
lowest score, as determined by the scoring function provided.
"""
return sorted(self._score_ngrams(score_fn),
key=_itemgetter(1), reverse=True)
def Harmonize(tonic, scale, interval, non_harmonic='below'):
"""
A diatonic harmonizer.
:param tonic:
The tonic of the scale, as a note name.
:param scale:
The type/mode, of the scale, one of:
``'major'``, ``'minor'``, ``'minor_harmonic'``, ``'ionian'``,
``'dorian'``, ``'phrygian'``, ``'lydian'``, ``'mixolydian'``,
``'aeolian'``, ``'locrian'``.
:param interval:
The number of steps to transpose the notes by
(as an integer), or one of these interval names:
``'unison'``, ``'second'``, ``'third'``, ``'fourth'``, ``'fifth'``,
``'sixth'``, ``'seventh'``, ``'octave'``, ``'ninth'``, ``'tenth'``,
``'eleventh'``, ``'twelfth'``, ``'thirteenth'``.
It is also possible to pass a list of intervals, to create
multiple harmonized voices.
:param non_harmonic: What to do with out-of-scale notes:
- ``'below'``: Transpose by the same interval as the next on-scale
- ``'above'``: Transpose by the same interval as the next on-scale
- ``'skip'``: Ignore note.
- ``'same'``: Output note as is, without transposing it.
"""
t = _util.tonic_note_number(tonic)
if _misc.issequence(scale):
shift = 0
elif isinstance(scale, str):
if scale == 'major':
scale = _MAJOR_SCALE
shift = 0
elif scale == 'minor':
scale = _MAJOR_SCALE
shift = 5
elif scale == 'minor_harmonic':
scale = _HARMONIC_MINOR_SCALE
shift = 0
elif scale in _MODES:
shift = _MODES.index(scale)
scale = _MAJOR_SCALE
# shift scale to the correct mode
s = ([x - scale[shift] for x in scale[shift:]] +
[x + 12 - scale[shift] for x in scale[:shift]])
if not _misc.issequence(interval):
interval = [interval]
# convert all interval names to numbers
iv = [(_INTERVALS.index(x) if x in _INTERVALS else x) for x in interval]
# python version:
# f = [ _m.Process(_Harmonizer(t, s, i, non_harmonic)) for i in iv ]
# pure mididings version:
f = []
for i in iv:
h = _Harmonizer(t, s, i, non_harmonic)
# get offset for each key
offsets = [(x, h.note_offset(x)) for x in range(128)]
# group by offset
groups = _itertools.groupby(sorted(offsets, key=_itemgetter(1)),
key=_itemgetter(1))
# create one KeyFilter()/Transpose() pair for each offset
for off, keys in groups:
if off is not None:
f.append(
_m.KeyFilter(notes=[k[0]
for k in keys]) >> _m.Transpose(off))
return _m.Filter(_m.NOTE) % f
def most_common(self, n=None):
if n is None:
return sorted(self.iteritems(), key=_itemgetter(1), reverse=True)
return _heapq.nlargest(n, self.iteritems(), key=_itemgetter(1))
try:
from _collections import OrderedDict
except ImportError:
# Leave the pure Python version in place.
pass
################################################################################
### namedtuple
################################################################################
try:
from _collections import _tuplegetter
except ImportError:
_tuplegetter = lambda index, doc: property(_itemgetter(index), doc=doc)
def namedtuple(typename, field_names, *, rename=False, defaults=None, module=None):
"""Returns a new subclass of tuple with named fields.
>>> Point = namedtuple('Point', ['x', 'y'])
>>> Point.__doc__ # docstring for the new class
'Point(x, y)'
>>> p = Point(11, y=22) # instantiate with positional args or keywords
>>> p[0] + p[1] # indexable like a plain tuple
33
>>> x, y = p # unpack like a regular tuple
>>> x, y
(11, 22)
>>> p.x + p.y # fields also accessible by name
33
def create_struct_class(field_names):
# type: (Iterable[str]) -> Type
field_names = tuple(field_names)
struct_class = _CLASS_CACHE.get(field_names)
if struct_class:
return struct_class
# Variables used in the methods and docstrings
for name in field_names:
if not all(c.isalnum() or c == "_" for c in name):
raise ValueError(
"Field names can only contain alphanumeric characters and underscores: %r"
% name)
if _iskeyword(name):
raise ValueError("Field names cannot be a keyword: %r" % name)
if name[0].isdigit():
raise ValueError("Field names cannot start with a number: %r" %
name)
arg_list = repr(field_names).replace("'", "")[1:-1]
repr_fmt = "(" + ", ".join(name + "=%r" for name in field_names) + ")"
tuple_new = tuple.__new__
# Create all the named tuple methods to be added to the class namespace
s = ("def __new__(_cls, " + arg_list + "): return _tuple_new(_cls, (" +
arg_list + "))")
namespace = {"_tuple_new": tuple_new, "__name__": _TYPENAME}
# Note: exec() has the side-effect of interning the field names
exec s in namespace
__new__ = namespace["__new__"]
def __repr__(self):
"""Return a nicely formatted representation string"""
return self.__class__.__name__ + repr_fmt % self
def _asdict(self):
"""Return a new OrderedDict which maps field names to their values."""
return OrderedDict(zip(self._fields, self))
def to_json(self):
"""Creates a JSON string representation of this struct instance."""
return json.dumps(self,
cls=StructEncoder,
separators=(",", ":"),
sort_keys=True)
# Build-up the class namespace dictionary
# and use type() to build the result class
class_namespace = {
"__slots__": (),
"_fields": field_names,
"__new__": __new__,
"__repr__": __repr__,
"_asdict": _asdict,
"to_json": to_json,
}
cache = _nt_itemgetters
for index, name in enumerate(field_names):
try:
itemgetter_object = cache[index]
except KeyError:
itemgetter_object = _itemgetter(index)
cache[index] = itemgetter_object
class_namespace[name] = property(itemgetter_object)
struct_class = type(_TYPENAME, (tuple, ), class_namespace)
_CLASS_CACHE[field_names] = struct_class
return struct_class
class Point(tuple):
'Point(quantity, price)'
__slots__ = ()
_fields = ('quantity', 'price')
def __new__(_cls, quantity, price):
'Create new instance of Point(quantity, price)'
if (quantity < 0 or quantity is None):
raise ValueError(
'The quantity provided ({}) is an invalid value.'.format(
quantity))
if (price < 0 or price is None):
raise ValueError(
'The price provided ({}) is an invalid value.'.format(price))
float_quantity = float(quantity)
float_price = float(price)
return _tuple.__new__(_cls, (float_quantity, float_price))
@classmethod
def _make(cls, iterable, new=tuple.__new__, len=len):
'Make a new Point object from a sequence or iterable'
result = new(cls, iterable)
if len(result) != 2:
raise TypeError('Expected 2 arguments, got %d' % len(result))
return result
def __repr__(self):
'Return a nicely formatted representation string'
return 'Point(quantity=%r, price=%r)' % self
def _asdict(self):
'Return a new OrderedDict which maps field names to their values'
return OrderedDict(zip(self._fields, self))
def _replace(_self, **kwds):
'Return a new Point object replacing specified fields with new values'
result = _self._make(map(kwds.pop, ('quantity', 'price'), _self))
if kwds:
raise ValueError('Got unexpected field names: %r' %
list(kwds.keys()))
return result
def __getnewargs__(self):
'Return self as a plain tuple. Used by copy and pickle.'
return tuple(self)
__dict__ = _property(_asdict)
def __getstate__(self):
'Exclude the OrderedDict from pickling'
pass
def tuppleize(self):
return (self.quantity, self.price)
quantity = _property(_itemgetter(0), doc='Alias for field number 0')
x = _property(_itemgetter(0), doc='Alias for field number 0')
price = _property(_itemgetter(1), doc='Alias for field number 1')
y = _property(_itemgetter(1), doc='Alias for field number 1')
class Position(tuple):
'Position(top, right, bottom, left)'
__slots__ = ()
_fields = ('top', 'right', 'bottom', 'left')
def __new__(_cls, top, right, bottom, left):
'Create new instance of Position(top, right, bottom, left)'
return _tuple.__new__(_cls, (top, right, bottom, left))
@classmethod
def make(cls, in_iterable, new=tuple.__new__, len=len):
"""Make a new Position object from a sequence or iterable
Parameters
---------
in_iterable
List of parameters to set position. Rules are same as in CSS
(padding, margin, border etc.):
- 1 value sets all 4 fields.
- 2 values: (first sets top and bottom, 2nd sets left and right)
- 3 values: (first sets top, second left/right and third bottom
- 4 values: (sets in order: top, right, bottom, left)
"""
if len(in_iterable) == 1:
iterable = itertools.repeat(in_iterable[0], 4)
elif len(in_iterable) == 2:
iterable = [
in_iterable[0], in_iterable[1], in_iterable[0], in_iterable[1]
]
elif len(in_iterable) == 3:
iterable = in_iterable + [in_iterable[1]]
else:
iterable = in_iterable
result = new(cls, iterable)
if len(result) != 4:
raise TypeError('Expected 4 arguments, got %d' % len(result))
return result
def _replace(_self, **kwds):
'Return a new Position object replacing specified fields with new values'
result = _self._make(
map(kwds.pop, ('top', 'right', 'bottom', 'left'), _self))
if kwds:
raise ValueError('Got unexpected field names: %r' % list(kwds))
return result
def __repr__(self):
'Return a nicely formatted representation string'
return self.__class__.__name__ + '(top=%r, right=%r, bottom=%r, left=%r)' % self
def _asdict(self):
'Return a new OrderedDict which maps field names to their values.'
return collections.OrderedDict(zip(self._fields, self))
def __getnewargs__(self):
'Return self as a plain tuple. Used by copy and pickle.'
return tuple(self)
top = _property(_itemgetter(0), doc='top margin/padding')
right = _property(_itemgetter(1), doc='right margin/padding')
bottom = _property(_itemgetter(2), doc='bottom margin/padding')
left = _property(_itemgetter(3), doc='left margin/padding')