def most_common(self, n=None): '''List the n most common elements and their counts from the most common to the least. If n is None, then list all element counts. >>> Counter('abcdeabcdabcaba').most_common(3) [('a', 5), ('b', 4), ('c', 3)] ''' # Emulate Bag.sortedByCount from Smalltalk if n is None: return sorted(self.items(), key=_itemgetter(1), reverse=True) return _heapq.nlargest(n, self.items(), key=_itemgetter(1))
def most_common(self, n=None): '''List the n most common elements and their counts from the most common to the least. If n is None, then list all element counts. >>> Counter('abracadabra').most_common(3) [('a', 5), ('r', 2), ('b', 2)] ''' # Emulate Bag.sortedByCount from Smalltalk if n is None: return sorted(self.iteritems(), key=_itemgetter(1), reverse=True) # Modified to avoid use of _heapq return sorted(self.iteritems(), key=_itemgetter(1), reverse=True)[:n]
def print_result(counter): sum_ = 0 for key, count in sorted(counter.items(), key=_itemgetter(1), reverse=True): sum_ += count print("{1:6d}x DXFType: {0}".format(key, count)) print("Overall sum: {0}".format(sum_))
def create_struct_class(field_names): # type: (Iterable[str]) -> Type field_names = tuple(field_names) struct_class = _CLASS_CACHE.get(field_names) if struct_class: return struct_class # Variables used in the methods and docstrings for name in field_names: if not all(c.isalnum() or c == "_" for c in name): raise ValueError( "Field names can only contain alphanumeric characters and underscores: %r" % name ) if _iskeyword(name): raise ValueError("Field names cannot be a keyword: %r" % name) if name[0].isdigit(): raise ValueError("Field names cannot start with a number: %r" % name) arg_list = repr(field_names).replace("'", "")[1:-1] tuple_new = tuple.__new__ # Create all the named tuple methods to be added to the class namespace s = ( "def __new__(_cls, " + arg_list + "): return _tuple_new(_cls, (" + arg_list + "))" ) namespace = {"_tuple_new": tuple_new, "__name__": _TYPENAME} # Note: exec() has the side-effect of interning the field names exec(s, namespace) __new__ = namespace["__new__"] # Build-up the class namespace dictionary # and use type() to build the result class class_namespace = { "__slots__": (), "_fields": field_names, "__new__": __new__, "__repr__": _create_struct_repr(field_names), "_asdict": _asdict, "to_json": _to_json, } cache = _nt_itemgetters for index, name in enumerate(field_names): try: itemgetter_object = cache[index] except KeyError: itemgetter_object = _itemgetter(index) cache[index] = itemgetter_object class_namespace[name] = property(itemgetter_object) struct_class = type(_TYPENAME, (tuple,), class_namespace) _CLASS_CACHE[field_names] = struct_class return struct_class
def __new__(mcl, name, parents, dct): if name == "TypedNamedTuple": return super(TypedNamedTupleMeta, mcl).__new__(mcl, name, parents, dct) fields = [] for k, v in dct.items(): if k.startswith("_"): continue if isinstance(v, TProp): fields.append((k,) + v) if fields: fields = sorted(fields, key=lambda f: f[1]) field_names = tuple(f[0] for f in fields) new_dct = {k: v for k, v in dct.items() if k not in field_names} if fields: new_dct["_fields"] = field_names types = {} for field_name, idx in zip(field_names, range(len(field_names))): new_dct[field_name] = property(_itemgetter(idx), doc='Alias for field number %d' % idx) types[field_name] = fields[idx][2] new_dct["_types"] = types # Make vars() work on result new_dct["__dict__"] = property(parents[0]._asdict) ret = super(TypedNamedTupleMeta, mcl).__new__(mcl, name, parents, new_dct) return ret
def namedtuple(typename, field_names, verbose=False): """Returns a new subclass of tuple with named fields. >>> Point = namedtuple('Point', 'x y') >>> Point.__doc__ # docstring for the new class 'Point(x, y)' >>> p = Point(11, y=22) # instantiate with positional args or keywords >>> p[0] + p[1] # indexable like a plain tuple 33 >>> x, y = p # unpack like a regular tuple >>> x, y (11, 22) >>> p.x + p.y # fields also accessable by name 33 >>> d = p._asdict() # convert to a dictionary >>> d['x'] 11 >>> Point(**d) # convert from a dictionary Point(x=11, y=22) >>> p._replace(x=100) # _replace() is like str.replace() but targets named fields Point(x=100, y=22) """ # Parse and validate the field names. Validation serves two purposes, # generating informative error messages and preventing template injection attacks. if isinstance(field_names, basestring): # names separated by whitespace and/or commas field_names = field_names.replace(',', ' ').split() field_names = list(field_names) seen_names = set() for name in [typename] + field_names: if not all(c.isalnum() or c=='_' for c in name): raise ValueError('Names can only contain alphanumeric characters and underscores: %r' % name) if _iskeyword(name): raise ValueError('Encountered duplicate field name: %r' % name) if name[0].isdigit(): raise ValueError('Type names and field names cannot start with a number: %r' % name) seen_names.add(name) name_to_field = dict((v, idx) for idx, v in (enumerate(field_names))) attributes = {'_field_names' : name_to_field, '_fields' : tuple(field_names), # immutable and we need it often '_field_len' : len(field_names), '__slots__' : (), '__doc__': "%s(%s)" % (typename, ', '.join(field_names))} # create properties for attr, idx in name_to_field.iteritems(): attributes[attr] = property(_itemgetter(idx)) if verbose: print attributes # create the new class, deriving from _NamedTuple result = type(typename, (_NamedTuple,), attributes) # For pickling to work, the __module__ variable needs to be set to the frame # where the named tuple is created. Bypass this step in enviroments where # sys._getframe is not defined (Jython for example). if hasattr(_sys, '_getframe'): result.__module__ = _sys._getframe(1).f_globals.get('__name__', '__main__') return result
class Character(tuple): """Character(name, owner, description, level, team, meta)""" __slots__ = () _fields = ('name', 'owner', 'description', 'level', 'team', 'meta', 'ustats') def __new__(_cls, name, owner, description, level, team, meta, ustats=None): 'Create new instance of Character(name, owner, description, level, team, meta)' if ustats is None: ustats = {} return _tuple.__new__( _cls, (name, owner, description, level, team, meta, ustats)) @classmethod def _make(cls, iterable, new=tuple.__new__, len=len): """Make a new Character object from a sequence or iterable""" result = new(cls, iterable) if len(result) != 6: raise TypeError('Expected 6 arguments, got %d' % len(result)) return result def _replace(_self, **kwds): """Return a new Character object replacing specified fields with new values""" result = _self._make( map(kwds.pop, ('name', 'owner', 'description', 'level', 'team', 'meta'), _self)) if kwds: raise ValueError('Got unexpected field names: %r' % list(kwds)) return result def __repr__(self): 'Return a nicely formatted representation string' return self.__class__.__name__ + '(name=%r, owner=%r, description=%r, level=%r, team=%r, meta=%r, ustats=%r)' % self def _asdict(self): 'Return a new OrderedDict which maps field names to their values.' return OrderedDict(zip(self._fields, self)) def __getnewargs__(self): 'Return self as a plain tuple. Used by copy and pickle.' return tuple(self) name = _property(_itemgetter(0), doc='Alias for field number 0') owner = _property(_itemgetter(1), doc='Alias for field number 1') description = _property(_itemgetter(2), doc='Alias for field number 2') level = _property(_itemgetter(3), doc='Alias for field number 3') team = _property(_itemgetter(4), doc='Alias for field number 4') meta = _property(_itemgetter(5), doc='Alias for field number 5') ustats = _property(_itemgetter(6), doc='Alias for field number 6')
def transform_theory_atom(x): """ Transforms the given theory atom. """ atoms = [] atom = TheoryAtomTransformer(atoms)(x) # maps atoms to a set of numeric ranges numeric = {} # maps ranges to a set of symbolic ranges other = {} # add to symbolic ranges converting numeric ranges def add(atm, lhs, rhs): if isinstance(lhs, _Number): lhs = _ast.SymbolicTerm(atom.location, _clingo.Number(lhs)) if rhs == float("inf"): rhs = _ast.SymbolicTerm(atom.location, _clingo.Supremum) elif isinstance(rhs, _Number): rhs = _ast.SymbolicTerm(atom.location, _clingo.Number(rhs)) rng = (lhs, rhs) other.setdefault(rng, (rng, {}))[1].setdefault(atm, atm) # split into numeric and symbolic ranges for atm, (lhs, rhs) in atoms: if isinstance(lhs, _Number) and isinstance(rhs, _Number): numeric.setdefault(atm, (atm, IntervalSet()))[1].add((lhs, rhs+1)) else: add(atm, lhs, rhs) # add combined numeric ranges as symbolic ranges for atm, rngs in numeric.values(): for lhs, rhs in rngs: add(atm, lhs, rhs-1) # flatten symbolic ranges into a list ranges = [] for _, (rng, atoms) in sorted(other.items(), key=_itemgetter(0)): ranges.append((rng, [atm for _, atm in sorted(atoms.items(), key=_itemgetter(0))])) return atom, ranges
def _get_dataruns(self): '''Returns a list of dataruns, in order. ''' if self._data_runs is None: raise DataStreamError("Resident datastream don't have dataruns") if not self._data_runs_sorted: self._data_runs.sort(key=_itemgetter(0)) self._data_runs_sorted = True return [data[1] for data in self._data_runs]
class Point(tuple): 'Point(x, y)' __slots__ = () _fields = ('x', 'y') def __new__(_cls, x, y): 'Create new instance of Point(x, y)' return _tuple.__new__(_cls, (x, y)) @classmethod def _make(cls, iterable, new=tuple.__new__, len=len): 'Make a new Point object from a sequence or iterable' result = new(cls, iterable) if len(result) != 2: raise TypeError('Expected 2 arguments, got %d' % len(result)) return result def _replace(_self, **kwds): 'Return a new Point object replacing specified fields with new values' result = _self._make(map(kwds.pop, ('x', 'y'), _self)) if kwds: raise ValueError('Got unexpected field names: %r' % list(kwds)) return result def __repr__(self): 'Return a nicely formatted representation string' return self.__class__.__name__ + '(x=%r, y=%r)' % self def _asdict(self): 'Return a new OrderedDict which maps field names to their values.' return OrderedDict(zip(self._fields, self)) def __getnewargs__(self): 'Return self as a plain tuple. Used by copy and pickle.' return tuple(self) x = _property(_itemgetter(0), doc='Alias for field number 0') y = _property(_itemgetter(1), doc='Alias for field number 1')
class PositionalSpec(tuple): """ Encapsulates the parse specification for a positional argument group. NOTE(josh): this is a named tuple with default arguments and some init processing. If it wasn't for the init processing, we could just do: PositionalSpec = collections.namedtuple( "PositionalSpec", ["nargs", ...]) PositionalSpec.__new__.__defaults__ = (False, None, None, False) But we don't want to self.tags and self.flags to point to a mutable global variable... """ def __new__(cls, nargs, sortable=False, tags=None, flags=None, legacy=False): if not tags: tags = [] if not flags: flags = [] return tuple.__new__(cls, (nargs, sortable, tags, flags, legacy)) nargs = property(_itemgetter(0)) npargs = property(_itemgetter(0)) sortable = property(_itemgetter(1)) tags = property(_itemgetter(2)) flags = property(_itemgetter(3)) legacy = property(_itemgetter(4))
class PositionalSpec(tuple): """ Encapsulates the parse specification for a positional argument group. NOTE(josh): this is a named tuple with default arguments and some init processing. If it wasn't for the init processing, we could just do: PositionalSpec = collections.namedtuple( "PositionalSpec", ["nargs", ...]) PositionalSpec.__new__.__defaults__ = (False, None, None, False) But we don't want to self.tags and self.flags to point to a mutable global variable... """ def __new__(cls, nargs, sortable=False, tags=None, flags=None, legacy=False, max_pargs_hwrap=None, always_wrap=None): if not tags: tags = [] if not flags: flags = [] return tuple.__new__(cls, (nargs, sortable, tags, flags, legacy, max_pargs_hwrap, always_wrap)) nargs = property(_itemgetter(0)) npargs = property(_itemgetter(0)) sortable = property(_itemgetter(1)) tags = property(_itemgetter(2)) flags = property(_itemgetter(3)) legacy = property(_itemgetter(4)) max_pargs_hwrap = property(_itemgetter(5)) always_wrap = property(_itemgetter(6)) def replace(self, **kwargs): selfdict = { "nargs": self.nargs, "sortable": self.sortable, "tags": list(self.tags), "flags": list(self.flags), "legacy": self.legacy, "max_pargs_hwrap": self.max_pargs_hwrap, "always_wrap": self.always_wrap } selfdict.update(kwargs) return PositionalSpec(**selfdict)
class TreeChangeTuple(tuple): 'TreeChangeTuple(type, old, new)' __slots__ = () _fields = ('type', 'old', 'new') def __new__(_cls, type, old, new): return _tuple.__new__(_cls, (type, old, new)) @classmethod def _make(cls, iterable, new=tuple.__new__, len=len): 'Make a new TreeChangeTuple object from a sequence or iterable' result = new(cls, iterable) if len(result) != 3: raise TypeError('Expected 3 arguments, got %d' % len(result)) return result def __repr__(self): return 'TreeChangeTuple(type=%r, old=%r, new=%r)' % self def _asdict(t): 'Return a new dict which maps field names to their values' return {'type': t[0], 'old': t[1], 'new': t[2]} def _replace(_self, **kwds): 'Return a new TreeChangeTuple object replacing specified fields with new values' result = _self._make(map(kwds.pop, ('type', 'old', 'new'), _self)) if kwds: raise ValueError('Got unexpected field names: %r' % kwds.keys()) return result def __getnewargs__(self): return tuple(self) type = _property(_itemgetter(0)) old = _property(_itemgetter(1)) new = _property(_itemgetter(2))
def get_score(cards): main = None values = list(get_values(cards)) while 1 in values: values.remove(1) values.append(14) if is_royal_flush(cards): main = 9 values = [14, 13, 12, 11, 10] elif is_straight_flush(cards): main = 8 if 1 in cards and 2 in cards: values.remove(14) values.append(1) values = sorted(values, reverse=True) elif is_four_of_a_kind(cards): main = 7 values = list(_chain.from_iterable(map(lambda item: [item[0]] * item[1], sorted(_Counter(values).items(), key=_itemgetter(1), reverse=True)))) elif is_full_house(cards): main = 6 values = list(_chain.from_iterable(map(lambda item: [item[0]] * item[1], sorted(_Counter(values).items(), key=_itemgetter(1), reverse=True)))) elif is_flush(cards): main = 5 values = sorted(values, reverse=True) elif is_straight(cards): main = 4 if 1 in cards and 2 in cards: values.remove(14) values.append(1) values = sorted(values, reverse=True) elif is_three_of_a_kind(cards): main = 3 values = list(_chain.from_iterable(map(lambda item: [item[0]] * item[1], sorted(_Counter(values).items(), key=_itemgetter(1), reverse=True)))) if values[3] < values[4]: values[3], values[4] = values[4], values[3] elif is_two_pair(cards): main = 2 values = list(_chain.from_iterable(map(lambda item: [item[0]] * item[1], sorted(_Counter(values).items(), key=_itemgetter(1), reverse=True)))) if values[0] < values[2]: values[0:2], values[2:4] = values[2:4], values[0:2] elif is_one_pair(cards): main = 1 values = list(_chain.from_iterable(map(lambda item: [item[0]] * item[1], sorted(_Counter(values).items(), key=_itemgetter(1), reverse=True)))) high = max(tuple(enumerate(values))[2:], key=_itemgetter(1))[0] values[2], values[high] = values[high], values[2] if values[3] < values[4]: values[3], values[4] = values[4], values[3] else: main = 0 values = sorted(values, reverse=True) return [main] + values
def __new__(cls, *args, **kwargs): if not len(args) + len(kwargs) == cls._field_len: raise TypeError("Invalid number of arguments!") arguments = list(args) if kwargs: def name_to_position(pair): return cls._field_names[pair[0]] try: sorted_args = sorted(kwargs.iteritems(), key=name_to_position) # sorted by key, but we only need the value arguments.extend(_imap(_itemgetter(1), sorted_args)) except KeyError: raise TypeError("Invalid arguments!") return tuple.__new__(cls, arguments)
def _observation_picker(station, system="G"): try: system = _SYSTEM_NAME[system.upper()] except KeyError: raise Warning("Unknown Satellite System:", system, "OPTIONS: G-R-E-C-J-R-I-S") #------------------------------------------------------------------- # RINEX-3 if station.version.startswith("3"): observation_codes = station.observation.columns.tolist() system_observations = getattr(station.observation_types, system) band_list = set("L" + code[1] for code in observation_codes if len(code) == 3) channel_list = set( [code[2] for code in observation_codes if len(code) == 3]) obs_codes = [] for band in band_list: if band in _SYSTEM_RNX3[system]: for channel in channel_list: if (band + channel ) in _SYSTEM_RNX3[system][band]["Carrierphase"] and ( band + channel) in system_observations: obs_codes.append([ system, band, (band + channel), ("C" + band[1] + channel), _SYSTEM_RNX3[system][band]["Frequency"] ]) break # RINEX-2 elif station.version.startswith("2"): observation_codes = station.observation.columns.tolist() system_observations = station.observation_types band_list = set(code for code in observation_codes if code.startswith(("L"))) obs_codes = [] for band in band_list: if band in _SYSTEM_RNX2[system].keys(): for code in _SYSTEM_RNX2[system][band]["Pseudorange"]: if code in system_observations: obs_codes.append([ system, band, band, code, _SYSTEM_RNX2[system][band]["Frequency"] ]) break obs_codes = sorted(obs_codes, key=_itemgetter(1)) return (obs_codes[0], obs_codes[1])
def less_than(self,maxvalue,ret='list'): temp = sorted(self.items(),key=_itemgetter(1)) low = 0 high = temp.__len__() while ((high-low) > 1): mid = (low+high) >> 1 if temp[mid][1] <= maxvalue: low = mid else: high = mid if temp[low][1]>maxvalue: if ret=='dict': return {} else: return [] if ret=='dict': ret_data = {} for ele,count in temp[:high]: ret_data[ele]=count return ret_data else: return temp[:high]
def less_than(self,maxvalue,ret='list'): temp = sorted(self.items(),key=_itemgetter(1)) low = 0 high = temp.__len__() while ((high-low) > 1): mid = (low+high) >> 1 if temp[mid][1] <= maxvalue: low = mid else: high = mid if temp[low][1]>maxvalue: if ret=='dict': return {} else: return [] if ret=='dict': ret_data = {} for ele,count in temp[:high]: ret_data[ele]=count return ret_data else: return temp[:high]
def larger_than(self, minvalue, ret='list'): temp = sorted(self.items(), key=_itemgetter(1), reverse=True) low = 0 high = temp.__len__() while high - low > 1: mid = (low + high) >> 1 if temp[mid][1] >= minvalue: low = mid else: high = mid if temp[low][1] < minvalue: if ret == 'dict': return {} else: return [] if ret == 'dict': ret_data = {} for ele, count in temp[:high]: ret_data[ele] = count return ret_data else: return temp[:high]
@classmethod def _make(cls, iterable, new=tuple.__new__, len=len): 'Make a new TIPO object from a sequence or iterable' result = new(cls, iterable) if len(result) != 1: raise TypeError('Expected 1 arguments, got %d' % len(result)) return result def _replace(_self, **kwds): 'Return a new TIPO object replacing specified fields with new values' result = _self._make(map(kwds.pop, ('VALOR',), _self)) if kwds: raise ValueError('Got unexpected field names: %r' % list(kwds)) return result def __repr__(self): 'Return a nicely formatted representation string' return self.__class__.__name__ + '(VALOR=%r)' % self def _asdict(self): 'Return a new OrderedDict which maps field names to their values.' return OrderedDict(zip(self._fields, self)) def __getnewargs__(self): 'Return self as a plain tuple. Used by copy and pickle.' return tuple(self) VALOR = _property(_itemgetter(0), doc='Alias for field number 0')
def create_struct_class(field_names): # type: (Iterable[str]) -> Type field_names = tuple(field_names) struct_class = _CLASS_CACHE.get(field_names) if struct_class: return struct_class # Variables used in the methods and docstrings for name in field_names: if not all(c.isalnum() or c == "_" for c in name): raise ValueError( "Field names can only contain alphanumeric characters and underscores: %r" % name ) if _iskeyword(name): raise ValueError("Field names cannot be a keyword: %r" % name) if name[0].isdigit(): raise ValueError("Field names cannot start with a number: %r" % name) arg_list = repr(field_names).replace("'", "")[1:-1] repr_fmt = "(" + ", ".join(name + "=%r" for name in field_names) + ")" tuple_new = tuple.__new__ # Create all the named tuple methods to be added to the class namespace s = ( "def __new__(_cls, " + arg_list + "): return _tuple_new(_cls, (" + arg_list + "))" ) namespace = {"_tuple_new": tuple_new, "__name__": _TYPENAME} # Note: exec() has the side-effect of interning the field names exec s in namespace __new__ = namespace["__new__"] def __repr__(self): """Return a nicely formatted representation string""" return self.__class__.__name__ + repr_fmt % self def _asdict(self): """Return a new OrderedDict which maps field names to their values.""" return OrderedDict(zip(self._fields, self)) def to_json(self): """Creates a JSON string representation of this struct instance.""" return json.dumps( self, cls=StructEncoder, separators=(",", ":"), sort_keys=True ) # Build-up the class namespace dictionary # and use type() to build the result class class_namespace = { "__slots__": (), "_fields": field_names, "__new__": __new__, "__repr__": __repr__, "_asdict": _asdict, "to_json": to_json, } cache = _nt_itemgetters for index, name in enumerate(field_names): try: itemgetter_object = cache[index] except KeyError: itemgetter_object = _itemgetter(index) cache[index] = itemgetter_object class_namespace[name] = property(itemgetter_object) struct_class = type(_TYPENAME, (tuple,), class_namespace) _CLASS_CACHE[field_names] = struct_class return struct_class
def most_common(self, n = None): if n is None: return sorted(self.iteritems(), key=_itemgetter(1), reverse=True) return _heapq.nlargest(n, self.iteritems(), key=_itemgetter(1))
def Harmonize(tonic, scale, interval, non_harmonic='below'): """ A diatonic harmonizer. :param tonic: The tonic of the scale, as a note name. :param scale: The type/mode, of the scale, one of: ``'major'``, ``'minor'``, ``'minor_harmonic'``, ``'ionian'``, ``'dorian'``, ``'phrygian'``, ``'lydian'``, ``'mixolydian'``, ``'aeolian'``, ``'locrian'``. :param interval: The number of steps to transpose the notes by (as an integer), or one of these interval names: ``'unison'``, ``'second'``, ``'third'``, ``'fourth'``, ``'fifth'``, ``'sixth'``, ``'seventh'``, ``'octave'``, ``'ninth'``, ``'tenth'``, ``'eleventh'``, ``'twelfth'``, ``'thirteenth'``. It is also possible to pass a list of intervals, to create multiple harmonized voices. :param non_harmonic: What to do with out-of-scale notes: - ``'below'``: Transpose by the same interval as the next on-scale - ``'above'``: Transpose by the same interval as the next on-scale - ``'skip'``: Ignore note. - ``'same'``: Output note as is, without transposing it. """ t = _util.tonic_note_number(tonic) if _misc.issequence(scale): shift = 0 elif isinstance(scale, str): if scale == 'major': scale = _MAJOR_SCALE shift = 0 elif scale == 'minor': scale = _MAJOR_SCALE shift = 5 elif scale == 'minor_harmonic': scale = _HARMONIC_MINOR_SCALE shift = 0 elif scale in _MODES: shift = _MODES.index(scale) scale = _MAJOR_SCALE # shift scale to the correct mode s = ([x - scale[shift] for x in scale[shift:]] + [x + 12 - scale[shift] for x in scale[:shift]]) if not _misc.issequence(interval): interval = [interval] # convert all interval names to numbers iv = [(_INTERVALS.index(x) if x in _INTERVALS else x) for x in interval] # python version: # f = [ _m.Process(_Harmonizer(t, s, i, non_harmonic)) for i in iv ] # pure mididings version: f = [] for i in iv: h = _Harmonizer(t, s, i, non_harmonic) # get offset for each key offsets = [(x, h.note_offset(x)) for x in range(128)] # group by offset groups = _itertools.groupby(sorted(offsets, key=_itemgetter(1)), key=_itemgetter(1)) # create one KeyFilter()/Transpose() pair for each offset for off, keys in groups: if off is not None: f.append(_m.KeyFilter(notes=[k[0] for k in keys]) >> _m.Transpose(off)) return _m.Filter(_m.NOTE) % f
def namedtuple(typename, field_names, *, rename=False, defaults=None, module=None): """Returns a new subclass of tuple with named fields. >>> Point = namedtuple('Point', ['x', 'y']) >>> Point.__doc__ # docstring for the new class 'Point(x, y)' >>> p = Point(11, y=22) # instantiate with positional args or keywords >>> p[0] + p[1] # indexable like a plain tuple 33 >>> x, y = p # unpack like a regular tuple >>> x, y (11, 22) >>> p.x + p.y # fields also accessible by name 33 >>> d = p._asdict() # convert to a dictionary >>> d['x'] 11 >>> Point(**d) # convert from a dictionary Point(x=11, y=22) >>> p._replace(x=100) # _replace() is like str.replace() but targets named fields Point(x=100, y=22) """ # Validate the field names. At the user's option, either generate an error # message or automatically replace the field name with a valid name. if isinstance(field_names, str): field_names = field_names.replace(',', ' ').split() field_names = list(map(str, field_names)) typename = _sys.intern(str(typename)) if rename: seen = set() for index, name in enumerate(field_names): if (not name.isidentifier() or _iskeyword(name) or name.startswith('_') or name in seen): field_names[index] = f'_{index}' seen.add(name) for name in [typename] + field_names: if type(name) is not str: raise TypeError('Type names and field names must be strings') if not name.isidentifier(): raise ValueError('Type names and field names must be valid ' f'identifiers: {name!r}') if _iskeyword(name): raise ValueError('Type names and field names cannot be a ' f'keyword: {name!r}') seen = set() for name in field_names: if name.startswith('_') and not rename: raise ValueError('Field names cannot start with an underscore: ' f'{name!r}') if name in seen: raise ValueError(f'Encountered duplicate field name: {name!r}') seen.add(name) field_defaults = {} if defaults is not None: defaults = tuple(defaults) if len(defaults) > len(field_names): raise TypeError('Got more default values than field names') field_defaults = dict( reversed(list(zip(reversed(field_names), reversed(defaults))))) # Variables used in the methods and docstrings field_names = tuple(map(_sys.intern, field_names)) num_fields = len(field_names) arg_list = repr(field_names).replace("'", "")[1:-1] repr_fmt = '(' + ', '.join(f'{name}=%r' for name in field_names) + ')' tuple_new = tuple.__new__ _len = len # Create all the named tuple methods to be added to the class namespace s = f'def __new__(_cls, {arg_list}): return _tuple_new(_cls, ({arg_list}))' namespace = {'_tuple_new': tuple_new, '__name__': f'namedtuple_{typename}'} # Note: exec() has the side-effect of interning the field names exec(s, namespace) __new__ = namespace['__new__'] __new__.__doc__ = f'Create new instance of {typename}({arg_list})' if defaults is not None: __new__.__defaults__ = defaults @classmethod def _make(cls, iterable): result = tuple_new(cls, iterable) if _len(result) != num_fields: raise TypeError( f'Expected {num_fields} arguments, got {len(result)}') return result _make.__func__.__doc__ = (f'Make a new {typename} object from a sequence ' 'or iterable') def _replace(_self, **kwds): result = _self._make(map(kwds.pop, field_names, _self)) if kwds: raise ValueError(f'Got unexpected field names: {list(kwds)!r}') return result _replace.__doc__ = (f'Return a new {typename} object replacing specified ' 'fields with new values') def __repr__(self): 'Return a nicely formatted representation string' return self.__class__.__name__ + repr_fmt % self def _asdict(self): 'Return a new OrderedDict which maps field names to their values.' return OrderedDict(zip(self._fields, self)) def __getnewargs__(self): 'Return self as a plain tuple. Used by copy and pickle.' return tuple(self) # Modify function metadata to help with introspection and debugging for method in (__new__, _make.__func__, _replace, __repr__, _asdict, __getnewargs__): method.__qualname__ = f'{typename}.{method.__name__}' # Build-up the class namespace dictionary # and use type() to build the result class class_namespace = { '__doc__': f'{typename}({arg_list})', '__slots__': (), '_fields': field_names, '_fields_defaults': field_defaults, '__new__': __new__, '_make': _make, '_replace': _replace, '__repr__': __repr__, '_asdict': _asdict, '__getnewargs__': __getnewargs__, } cache = _nt_itemgetters for index, name in enumerate(field_names): try: itemgetter_object, doc = cache[index] except KeyError: itemgetter_object = _itemgetter(index) doc = f'Alias for field number {index}' cache[index] = itemgetter_object, doc class_namespace[name] = property(itemgetter_object, doc=doc) result = type(typename, (tuple, ), class_namespace) # For pickling to work, the __module__ variable needs to be set to the frame # where the named tuple is created. Bypass this step in environments where # sys._getframe is not defined (Jython for example) or sys._getframe is not # defined for arguments greater than 0 (IronPython), or where the user has # specified a particular module. if module is None: try: module = _sys._getframe(1).f_globals.get('__name__', '__main__') except (AttributeError, ValueError): pass if module is not None: result.__module__ = module return result
def from_prototxt(text=None, filename=None): r""" Create an :py:class:`NetSpecification` object from a text spec. Either ``text`` or ``filename`` may be set, and is accordingly used. Files may be of any caffe prototxt version. """ # Check if the user erroneously specified a filename as text. if text is not None: if _os.linesep not in text: if _os.path.exists(text): _LOGGER.warn('You probably mistakenly specified a filename ' 'as text: "%s"! Trying to recover...', text) filename = text text = None if filename is not None: assert text is None # Do a conversion if necessary. with _NamedTemporaryFile(mode='r', suffix='.prototxt') as tmpfile: net_upgrader_exec = _os.path.join(_CAFFE_BIN_FOLDER, 'upgrade_net_proto_text') assert _os.path.exists(net_upgrader_exec),\ ("The executable 'upgrade_net_proto_text' was not found " "in your _CAFFE_BIN_FOLDER! Please set it from the " "module `barrista.config`. The current folder is set " "to: " + _CAFFE_BIN_FOLDER + ".") _subprocess.check_call([net_upgrader_exec, filename, tmpfile.name]) text = tmpfile.read() message = _caffe_pb2.NetParameter() _gprototext.Merge(text, message) # Check for completeness of the parsing process. fields = message.ListFields() for fielddesc in map(_itemgetter(0), fields): # pylint: disable=W0141 if fielddesc.name not in ['name', 'input_shape', 'debug_info', 'input', 'input_dim', 'layer', 'force_backward', 'state']: _LOGGER.warn('Parsed net prototxt contained unknown field ' + fielddesc.name + '. Ignored.') if len(message.input_dim) > 0: _LOGGER.warn('The loaded prototxt contains `input_dim` fields. ' 'They are deprecated! Use `input_shape` instead.') if _HAS_BLOB_SHAPE: assert len(message.input_shape) == 0 assert len(message.input_dim) % 4 == 0 input_shape = _copy.deepcopy(list(_chunks(message.input_dim, 4))) else: input_shape = _copy.deepcopy([bshape.dim for bshape in message.input_shape]) inputs = _copy.deepcopy(message.input) layerspecs = [LayerSpecification.from_pbuf_message(layer) for layer in message.layer] pbforcebw = message.force_backward phase = message.state.phase level = message.state.level stages = _copy.deepcopy(message.state.stage) debug_info = message.debug_info name = message.name spec = NetSpecification(input_shape, inputs, layerspecs, pbforcebw, phase, level, stages, debug_info, name) return spec
class VersionInfo(tuple): ''' Version number. This is a variation on a `namedtuple`. Example: VersionInfo(1, 2, 0) == \ VersionInfo(major=1, minor=2, micro=0, modifier='release') == \ (1, 2, 0) ''' __slots__ = () _fields = ('major', 'minor', 'micro', 'modifier') def __new__(cls, major, minor=0, micro=0, modifier='release'): ''' Create new instance of `VersionInfo(major, minor, micro, modifier)`. ''' assert isinstance(major, int) assert isinstance(minor, int) assert isinstance(micro, int) assert isinstance(modifier, basestring) return tuple.__new__(cls, (major, minor, micro, modifier)) @classmethod def _make(cls, iterable, new=tuple.__new__, len=len): '''Make a new `VersionInfo` object from a sequence or iterable.''' result = new(cls, iterable) if len(result) != 4: raise TypeError('Expected 4 arguments, got %d' % len(result)) return result def __repr__(self): '''Return a nicely formatted representation string.''' return 'VersionInfo(major=%r, minor=%r, micro=%r, modifier=%r)' % self def _asdict(self): ''' Return a new `OrderedDict` which maps field names to their values. ''' from python_toolbox.nifty_collections import OrderedDict return OrderedDict(zip(self._fields, self)) def _replace(self, **kwargs): ''' Make a `VersionInfo` object replacing specified fields with new values. ''' result = \ self._make(map(kwargs.pop, ('major', 'minor', 'micro', 'modifier'), self)) if kwargs: raise ValueError('Got unexpected field names: %r' % kwargs.keys()) return result def __getnewargs__(self): '''Return self as a plain tuple. Used by copy and pickle.''' return tuple(self) @property def version_text(self): '''A textual description of the version, like '1.4.2 beta'.''' version_text = '%s.%s.%s' % (self.major, self.minor, self.micro) if self.modifier != 'release': version_text += ' %s' % self.modifier return version_text major = property(_itemgetter(0)) minor = property(_itemgetter(1)) micro = property(_itemgetter(2)) modifier = property(_itemgetter(3))
def most_common(self, n=None): """list the n most common elements and their counts from the most common to the least. If n is None , then list all element counts""" if n is None: return sorted(self.iteritems(), key=_itemgetter(1), reverse=True)
def from_prototxt(text=None, filename=None): r""" Create an :py:class:`NetSpecification` object from a text spec. Either ``text`` or ``filename`` may be set, and is accordingly used. Files may be of any caffe prototxt version. """ # Check if the user erroneously specified a filename as text. if text is not None: if _os.linesep not in text: if _os.path.exists(text): # pragma: no cover _LOGGER.warn( 'You probably mistakenly specified a filename ' 'as text: "%s"! Trying to recover...', text) filename = text text = None if filename is not None: assert text is None # Do a conversion if necessary. with _NamedTemporaryFile(mode='r', suffix='.prototxt') as tmpfile: net_upgrader_exec = _os.path.join(_CAFFE_BIN_FOLDER, 'upgrade_net_proto_text') assert _os.path.exists(net_upgrader_exec),\ ("The executable 'upgrade_net_proto_text' was not found " "in your _CAFFE_BIN_FOLDER! Please set it from the " "module `barrista.config`. The current folder is set " "to: " + _CAFFE_BIN_FOLDER + ".") _subprocess.check_call( [net_upgrader_exec, filename, tmpfile.name]) text = tmpfile.read() message = _caffe_pb2.NetParameter() _gprototext.Merge(text, message) # Check for completeness of the parsing process. fields = message.ListFields() for fielddesc in map(_itemgetter(0), fields): # pylint: disable=W0141 if fielddesc.name not in [ 'name', 'input_shape', 'debug_info', 'input', 'input_dim', 'layer', 'force_backward', 'state' ]: _LOGGER.warn('Parsed net prototxt contained unknown field ' + fielddesc.name + '. Ignored.') if len(message.input_dim) > 0: _LOGGER.warn('The loaded prototxt contains `input_dim` fields. ' 'They are deprecated! Use `input_shape` instead.') if _HAS_BLOB_SHAPE: assert len(message.input_shape) == 0 assert len(message.input_dim) % 4 == 0 input_shape = _copy.deepcopy(list(_chunks(message.input_dim, 4))) else: # pragma: no cover input_shape = _copy.deepcopy( [bshape.dim for bshape in message.input_shape]) inputs = _copy.deepcopy(message.input) layerspecs = [ LayerSpecification.from_pbuf_message(layer) for layer in message.layer ] pbforcebw = message.force_backward phase = message.state.phase level = message.state.level stages = _copy.deepcopy(message.state.stage) debug_info = message.debug_info name = message.name spec = NetSpecification(input_shape, inputs, layerspecs, pbforcebw, phase, level, stages, debug_info, name) return spec
def common_sub_strings(stringx: str, stringy: str, limit=25): """Finds all common substrings between stringx and stringy longer than limit. This function is case sensitive. The substrings may overlap. returns a list of tuples describing the substrings The list is sorted longest -> shortest. Parameters ---------- stringx : str stringy : str limit : int, optional Returns ------- list of tuple [(startx1,starty1,length1),(startx2,starty2,length2), ...] startx1 = startposition in x, where substring 1 starts starty1 = position in y where substring 1 starts length1 = lenght of substring Examples -------- >>> from pydna.common_sub_strings import common_sub_strings >>> common_sub_strings("gatgatttcggtagtta", "gtcagtatgtctatctatcgcg", limit=3) [(1, 6, 3), (7, 17, 3), (10, 4, 3), (12, 3, 3)] :: Overlaps Symbols (1, 6, 3) --- (7, 17, 3) +++ (10, 4, 3) ... (12, 3, 3) === === gatgatttcggtagtta stringx --- +++... ... gtcagtatgtctatctatcgcg stringy ===--- +++ """ rstr = Rstr_max() rstr.add_str(stringx + "&" + stringy) r = rstr.go() match = {} # _defaultdict(int) for (offset_end, nb), (l, start_plage) in r.items(): startsx = [] startsy = [] if l < limit: continue for o in range(start_plage, start_plage + nb): offset = rstr.idxPos[rstr.res[o]] if offset > len(stringx): startsy.append(offset - len(stringx) - 1) else: startsx.append(offset) for a, b in _itertools.product(startsx, startsy): match[(a, b)] = max(match.get((a, b)) or 0, l) match = [(key[0], key[1], val) for key, val in list(match.items())] match.sort() match.sort(key=_itemgetter(2), reverse=True) return match
def most_common(mydict, n=None): if n is None: return sorted(mydict.items(), key=_itemgetter(1), reverse=True) return heapq.nlargest(n, mydict.items(), key=_itemgetter(1))
def most_common(self, n=None): """Return the `n` most common elements. """ if n is None: return sorted(self.items(), key=_itemgetter(1), reverse=True) return _heapq.nlargest(n, self.items(), key=_itemgetter(1))
def namedtuple(typename, field_names, verbose=False, rename=False): """Returns a new subclass of tuple with named fields. >>> Point = namedtuple('Point', 'x y') >>> Point.__doc__ # docstring for the new class 'Point(x, y)' >>> p = Point(11, y=22) # instantiate with positional args or keywords >>> p[0] + p[1] # indexable like a plain tuple 33 >>> x, y = p # unpack like a regular tuple >>> x, y (11, 22) >>> p.x + p.y # fields also accessable by name 33 >>> d = p._asdict() # convert to a dictionary >>> d['x'] 11 >>> Point(**d) # convert from a dictionary Point(x=11, y=22) >>> p._replace(x=100) # _replace() is like str.replace() but targets named fields Point(x=100, y=22) """ if not isinstance(typename, basestring): raise TypeError('typename must be a string, not %r' % type(typename)) err = _check_name(typename) if err: raise ValueError(err) # Parse and validate the field names. Validation serves two purposes, # generating informative error messages and preventing template # injection attacks. if isinstance(field_names, basestring): # Field names separated by whitespace and/or commas. field_names = field_names.replace(',', ' ').split() field_names = list(map(str, field_names)) seen = set() for i, name in enumerate(field_names): err = _check_name(name) if not err and name in seen: err = "duplicate name '%s'" % name if err: if rename: field_names[i] = "_%d" % i else: raise ValueError(err) else: seen.add(name) field_names = tuple(field_names) # === Dynamically construct the class === # Unlike Raymond Hettinger's original recipe found at # http://code.activestate.com/recipes/500261-named-tuples/ # we use a regular nested class. The only method which needs to be # generated dynamically is __new__. numfields = len(field_names) reprtxt = ', '.join('%s=%%r' % name for name in field_names) argtxt = ', '.join(field_names) class Inner(tuple): # Work around for annoyance: type __doc__ is read-only :-( __doc__ = ("%(typename)s(%(argtxt)s)" % {'typename': typename, 'argtxt': argtxt}) __slots__ = () _fields = field_names # Don't decorate with classmethod here. See below. def _make(cls, iterable, new=tuple.__new__, len=len): """Make a new %s object from a sequence or iterable.""" result = new(cls, iterable) if len(result) != numfields: raise TypeError('Expected %d arguments, got %d' % (numfields, len(result))) return result # Work around for annoyance: classmethod __doc__ is read-only :-( _make.__doc__ %= locals() _make = classmethod(_make) def __repr__(self): return '%s(%s)' % (typename, reprtxt%self) def _asdict(self): """Return a new dict which maps field names to their values.""" return dict(zip(self._fields, self)) def _replace(self, **kwds): """Return a new %(typename)s object replacing specified fields with new values.""" result = self._make(map(kwds.pop, self._fields, self)) #result = self._make(map(kwds.pop, ('x', 'y'), _self)) if kwds: raise ValueError('Got unexpected field names: %r' % kwds.keys()) return result def __getnewargs__(self): return tuple(self) # For pickling to work, the __module__ attribute needs to be set to the # frame where the named tuple is created. Bypass this step in enviroments # where sys._getframe is not defined (Jython for example) or sys._getframe # is not defined for arguments greater than 0 (IronPython). try: Inner.__module__ = _sys._getframe(1).f_globals.get('__name__', '__main__') except (AttributeError, ValueError): pass # Dynamically create the __new__ method and inject it into the class. # We do this using exec because the method argument handling is otherwise # too hard. The "cls" parameter is named _cls instead to avoid clashing # with a field of that same name. ns = {'_new': tuple.__new__} template = """def __new__(_cls, %(argtxt)s): return _new(_cls, (%(argtxt)s))""" % locals() if verbose: print template exec template in ns, ns Inner.__new__ = staticmethod(ns['__new__']) # NOT classmethod! # Inject properties to retrieve items by name. for i, name in enumerate(field_names): setattr(Inner, name, property(_itemgetter(i))) Inner.__dict__['_replace'].__doc__ %= locals() Inner.__name__ = typename return Inner
the_best = dict((x, y) for x, y in the_best) cont = dict() rows = [] total_songs_value = sum(total_songs.values()) with open('data/most_common_all_{}.csv'.format(pos_analysis), 'w') as f: writer = csv.writer(f) writer.writerow(["source", "target", "value"]) for year in total_most_common: word_counter = total_most_common[year] for tuple_w in word_counter: term = tuple_w[0] count = tuple_w[1] if term in the_best: if term not in cont: cont[term] = {year: count} else: cont[term].update({year: count}) years_words = dict() for w in cont: index = 0 for year in cont[w]: weight = cont[w][year] row = [w, year, weight / float(count_songs[index]) * 100] rows.append(row) index += 1 sorted(rows, key=_itemgetter(1)) for r in rows: writer.writerow(r)
def struct(**kwargs): """Creates an immutable container using the keyword arguments as attributes. It can be used to group multiple values and/or functions together. Example: def _my_function(): return 3 s = struct(x = 2, foo = _my_function) return s.x + s.foo() # returns 5 The implementation is almost identical to namedtuple, but: - it does not forbid fields starting with underscores - does not implement methods for pickling - does not support copy/deepcopy """ field_names = tuple(kwargs.keys()) for name in field_names: if not all(c.isalnum() or c == "_" for c in name): raise ValueError( "Field names can only contain alphanumeric characters and underscores: %r" % name) if _iskeyword(name): raise ValueError("Field names cannot be a keyword: %r" % name) if name[0].isdigit(): raise ValueError("Field names cannot start with a number: %r" % name) # Variables used in the methods and docstrings arg_list = repr(field_names).replace("'", "")[1:-1] repr_fmt = "(" + ", ".join(name + "=%r" for name in field_names) + ")" tuple_new = tuple.__new__ # Create all the named tuple methods to be added to the class namespace s = ("def __new__(_cls, " + arg_list + "): return _tuple_new(_cls, (" + arg_list + "))") namespace = {"_tuple_new": tuple_new, "__name__": _TYPENAME} # Note: exec() has the side-effect of interning the field names exec s in namespace __new__ = namespace["__new__"] def __repr__(self): """Return a nicely formatted representation string""" return self.__class__.__name__ + repr_fmt % self def _asdict(self): """Return a new OrderedDict which maps field names to their values.""" return OrderedDict(zip(self._fields, self)) def to_json(self): """Creates a JSON string representation of this struct instance.""" return json.dumps(self, cls=StructEncoder, separators=(",", ":"), sort_keys=True) # Build-up the class namespace dictionary # and use type() to build the result class class_namespace = { "__slots__": (), "_fields": field_names, "__new__": __new__, "__repr__": __repr__, "_asdict": _asdict, "to_json": to_json, } cache = _nt_itemgetters for index, name in enumerate(field_names): try: itemgetter_object = cache[index] except KeyError: itemgetter_object = _itemgetter(index) cache[index] = itemgetter_object class_namespace[name] = property(itemgetter_object) result = type(_TYPENAME, (tuple, ), class_namespace) return result(**kwargs)
def score_ngrams(self, score_fn): """Returns a sequence of (ngram, score) pairs ordered from highest to lowest score, as determined by the scoring function provided. """ return sorted(self._score_ngrams(score_fn), key=_itemgetter(1), reverse=True)
def namedtuple(typename, field_names, *, rename=False, defaults=None, module=None): """Returns a new subclass of tuple with named fields. >>> Point = namedtuple('Point', ['x', 'y']) >>> Point.__doc__ # docstring for the new class 'Point(x, y)' >>> p = Point(11, y=22) # instantiate with positional args or keywords >>> p[0] + p[1] # indexable like a plain tuple 33 >>> x, y = p # unpack like a regular tuple >>> x, y (11, 22) >>> p.x + p.y # fields also accessible by name 33 >>> d = p._asdict() # convert to a dictionary >>> d['x'] 11 >>> Point(**d) # convert from a dictionary Point(x=11, y=22) >>> p._replace(x=100) # _replace() is like str.replace() but targets named fields Point(x=100, y=22) """ # Validate the field names. At the user's option, either generate an error # message or automatically replace the field name with a valid name. if isinstance(field_names, str): field_names = field_names.replace(',', ' ').split() field_names = list(map(str, field_names)) typename = _sys.intern(str(typename)) if rename: seen = set() for index, name in enumerate(field_names): if (not name.isidentifier() or _iskeyword(name) or name.startswith('_') or name in seen): field_names[index] = f'_{index}' seen.add(name) for name in [typename] + field_names: if type(name) is not str: raise TypeError('Type names and field names must be strings') if not name.isidentifier(): raise ValueError('Type names and field names must be valid ' f'identifiers: {name!r}') if _iskeyword(name): raise ValueError('Type names and field names cannot be a ' f'keyword: {name!r}') seen = set() for name in field_names: if name.startswith('_') and not rename: raise ValueError('Field names cannot start with an underscore: ' f'{name!r}') if name in seen: raise ValueError(f'Encountered duplicate field name: {name!r}') seen.add(name) field_defaults = {} if defaults is not None: defaults = tuple(defaults) if len(defaults) > len(field_names): raise TypeError('Got more default values than field names') field_defaults = dict(reversed(list(zip(reversed(field_names), reversed(defaults))))) # Variables used in the methods and docstrings field_names = tuple(map(_sys.intern, field_names)) num_fields = len(field_names) arg_list = repr(field_names).replace("'", "")[1:-1] repr_fmt = '(' + ', '.join(f'{name}=%r' for name in field_names) + ')' tuple_new = tuple.__new__ _len = len # Create all the named tuple methods to be added to the class namespace s = f'def __new__(_cls, {arg_list}): return _tuple_new(_cls, ({arg_list}))' namespace = {'_tuple_new': tuple_new, '__name__': f'namedtuple_{typename}'} # Note: exec() has the side-effect of interning the field names exec(s, namespace) __new__ = namespace['__new__'] __new__.__doc__ = f'Create new instance of {typename}({arg_list})' if defaults is not None: __new__.__defaults__ = defaults @classmethod def _make(cls, iterable): result = tuple_new(cls, iterable) if _len(result) != num_fields: raise TypeError(f'Expected {num_fields} arguments, got {len(result)}') return result _make.__func__.__doc__ = (f'Make a new {typename} object from a sequence ' 'or iterable') def _replace(_self, **kwds): result = _self._make(map(kwds.pop, field_names, _self)) if kwds: raise ValueError(f'Got unexpected field names: {list(kwds)!r}') return result _replace.__doc__ = (f'Return a new {typename} object replacing specified ' 'fields with new values') def __repr__(self): 'Return a nicely formatted representation string' return self.__class__.__name__ + repr_fmt % self def _asdict(self): 'Return a new OrderedDict which maps field names to their values.' return OrderedDict(zip(self._fields, self)) def __getnewargs__(self): 'Return self as a plain tuple. Used by copy and pickle.' return tuple(self) # Modify function metadata to help with introspection and debugging for method in (__new__, _make.__func__, _replace, __repr__, _asdict, __getnewargs__): method.__qualname__ = f'{typename}.{method.__name__}' # Build-up the class namespace dictionary # and use type() to build the result class class_namespace = { '__doc__': f'{typename}({arg_list})', '__slots__': (), '_fields': field_names, '_fields_defaults': field_defaults, '__new__': __new__, '_make': _make, '_replace': _replace, '__repr__': __repr__, '_asdict': _asdict, '__getnewargs__': __getnewargs__, } cache = _nt_itemgetters for index, name in enumerate(field_names): try: itemgetter_object, doc = cache[index] except KeyError: itemgetter_object = _itemgetter(index) doc = f'Alias for field number {index}' cache[index] = itemgetter_object, doc class_namespace[name] = property(itemgetter_object, doc=doc) result = type(typename, (tuple,), class_namespace) # For pickling to work, the __module__ variable needs to be set to the frame # where the named tuple is created. Bypass this step in environments where # sys._getframe is not defined (Jython for example) or sys._getframe is not # defined for arguments greater than 0 (IronPython), or where the user has # specified a particular module. if module is None: try: module = _sys._getframe(1).f_globals.get('__name__', '__main__') except (AttributeError, ValueError): pass if module is not None: result.__module__ = module return result
def __iter__(self): c = self.conn.execute("SELECT key FROM Dict") return map(_itemgetter(0), c.fetchall())
try: from _collections import OrderedDict except ImportError: # Leave the pure Python version in place. pass ################################################################################ ### namedtuple ################################################################################ try: from _collections import _tuplegetter except ImportError: _tuplegetter = lambda index, doc: property(_itemgetter(index), doc=doc) def namedtuple(typename, field_names, *, rename=False, defaults=None, module=None): """Returns a new subclass of tuple with named fields. >>> Point = namedtuple('Point', ['x', 'y']) >>> Point.__doc__ # docstring for the new class 'Point(x, y)' >>> p = Point(11, y=22) # instantiate with positional args or keywords >>> p[0] + p[1] # indexable like a plain tuple
class StatsTuple(tuple): ''' tuple subclass used to track edit_distance and related values. Copy-and-paste-and-modify of NamedTuple _source with addition operator overridden Attributes: ---------- edit_distance : int num_deletions : int num_insertions :int num_substituions : int num_ref_elements :int ''' __slots__ = () _fields = ('edit_distance', 'num_deletions', 'num_insertions', 'num_substituions', 'num_ref_elements') def __new__(_cls, edit_distance, num_deletions, num_insertions, num_substituions, num_ref_elements): '''Create new instance of DiffStats(edit_distance, num_deletions, num_insertions, num_substituions, num_ref_elements, alignment)''' return _tuple.__new__(_cls, (edit_distance, num_deletions, num_insertions, num_substituions, num_ref_elements)) @classmethod def _make(cls, iterable, new=tuple.__new__, len=len): 'Make a new DiffStats object from a sequence or iterable' result = new(cls, iterable) if len(result) != 5: raise TypeError('Expected 5 arguments, got %d' % len(result)) return result def _replace(_self, **kwds): '''Return a new StatsTuple object replacing specified fields with new values''' result = _self._make( map(kwds.pop, ('edit_distance', 'num_deletions', 'num_insertions', 'num_substituions', 'num_ref_elements'), _self)) if kwds: raise ValueError('Got unexpected field names: %r' % list(kwds)) return result def __repr__(self): 'Return a nicely formatted representation string' return self.__class__.__name__ + ( '(edit_distance=%r, num_deletions=%r, num_insertions=%r, ' 'num_substituions=%r, num_ref_elements=%r)' % self) def _asdict(self): 'Return a new OrderedDict which maps field names to their values.' return OrderedDict(zip(self._fields, self)) def __getnewargs__(self): 'Return self as a plain tuple. Used by copy and pickle.' return tuple(self) def __add__(self, other): ''' add all the attributes together and return a new StatsTuple object ''' return StatsTuple(*(i + j for i, j in zip(self, other))) edit_distance = _property(_itemgetter(0), doc='Alias for field number 0') num_deletions = _property(_itemgetter(1), doc='Alias for field number 1') num_insertions = _property(_itemgetter(2), doc='Alias for field number 2') num_substituions = _property(_itemgetter(3), doc='Alias for field number 3') num_ref_elements = _property(_itemgetter(4), doc='Alias for field number 4')
def most_common(self, n=None): return sorted(self.iteritems(), key=_itemgetter(1), reverse=True)
def score_ngrams(self, score_fn): """Returns a sequence of (ngram, score) pairs ordered from highest to lowest score, as determined by the scoring function provided. """ return sorted(self._score_ngrams(score_fn), key=_itemgetter(1), reverse=True)
def Harmonize(tonic, scale, interval, non_harmonic='below'): """ A diatonic harmonizer. :param tonic: The tonic of the scale, as a note name. :param scale: The type/mode, of the scale, one of: ``'major'``, ``'minor'``, ``'minor_harmonic'``, ``'ionian'``, ``'dorian'``, ``'phrygian'``, ``'lydian'``, ``'mixolydian'``, ``'aeolian'``, ``'locrian'``. :param interval: The number of steps to transpose the notes by (as an integer), or one of these interval names: ``'unison'``, ``'second'``, ``'third'``, ``'fourth'``, ``'fifth'``, ``'sixth'``, ``'seventh'``, ``'octave'``, ``'ninth'``, ``'tenth'``, ``'eleventh'``, ``'twelfth'``, ``'thirteenth'``. It is also possible to pass a list of intervals, to create multiple harmonized voices. :param non_harmonic: What to do with out-of-scale notes: - ``'below'``: Transpose by the same interval as the next on-scale - ``'above'``: Transpose by the same interval as the next on-scale - ``'skip'``: Ignore note. - ``'same'``: Output note as is, without transposing it. """ t = _util.tonic_note_number(tonic) if _misc.issequence(scale): shift = 0 elif isinstance(scale, str): if scale == 'major': scale = _MAJOR_SCALE shift = 0 elif scale == 'minor': scale = _MAJOR_SCALE shift = 5 elif scale == 'minor_harmonic': scale = _HARMONIC_MINOR_SCALE shift = 0 elif scale in _MODES: shift = _MODES.index(scale) scale = _MAJOR_SCALE # shift scale to the correct mode s = ([x - scale[shift] for x in scale[shift:]] + [x + 12 - scale[shift] for x in scale[:shift]]) if not _misc.issequence(interval): interval = [interval] # convert all interval names to numbers iv = [(_INTERVALS.index(x) if x in _INTERVALS else x) for x in interval] # python version: # f = [ _m.Process(_Harmonizer(t, s, i, non_harmonic)) for i in iv ] # pure mididings version: f = [] for i in iv: h = _Harmonizer(t, s, i, non_harmonic) # get offset for each key offsets = [(x, h.note_offset(x)) for x in range(128)] # group by offset groups = _itertools.groupby(sorted(offsets, key=_itemgetter(1)), key=_itemgetter(1)) # create one KeyFilter()/Transpose() pair for each offset for off, keys in groups: if off is not None: f.append( _m.KeyFilter(notes=[k[0] for k in keys]) >> _m.Transpose(off)) return _m.Filter(_m.NOTE) % f
def most_common(self, n=None): if n is None: return sorted(self.iteritems(), key=_itemgetter(1), reverse=True) return _heapq.nlargest(n, self.iteritems(), key=_itemgetter(1))
try: from _collections import OrderedDict except ImportError: # Leave the pure Python version in place. pass ################################################################################ ### namedtuple ################################################################################ try: from _collections import _tuplegetter except ImportError: _tuplegetter = lambda index, doc: property(_itemgetter(index), doc=doc) def namedtuple(typename, field_names, *, rename=False, defaults=None, module=None): """Returns a new subclass of tuple with named fields. >>> Point = namedtuple('Point', ['x', 'y']) >>> Point.__doc__ # docstring for the new class 'Point(x, y)' >>> p = Point(11, y=22) # instantiate with positional args or keywords >>> p[0] + p[1] # indexable like a plain tuple 33 >>> x, y = p # unpack like a regular tuple >>> x, y (11, 22) >>> p.x + p.y # fields also accessible by name 33
def create_struct_class(field_names): # type: (Iterable[str]) -> Type field_names = tuple(field_names) struct_class = _CLASS_CACHE.get(field_names) if struct_class: return struct_class # Variables used in the methods and docstrings for name in field_names: if not all(c.isalnum() or c == "_" for c in name): raise ValueError( "Field names can only contain alphanumeric characters and underscores: %r" % name) if _iskeyword(name): raise ValueError("Field names cannot be a keyword: %r" % name) if name[0].isdigit(): raise ValueError("Field names cannot start with a number: %r" % name) arg_list = repr(field_names).replace("'", "")[1:-1] repr_fmt = "(" + ", ".join(name + "=%r" for name in field_names) + ")" tuple_new = tuple.__new__ # Create all the named tuple methods to be added to the class namespace s = ("def __new__(_cls, " + arg_list + "): return _tuple_new(_cls, (" + arg_list + "))") namespace = {"_tuple_new": tuple_new, "__name__": _TYPENAME} # Note: exec() has the side-effect of interning the field names exec s in namespace __new__ = namespace["__new__"] def __repr__(self): """Return a nicely formatted representation string""" return self.__class__.__name__ + repr_fmt % self def _asdict(self): """Return a new OrderedDict which maps field names to their values.""" return OrderedDict(zip(self._fields, self)) def to_json(self): """Creates a JSON string representation of this struct instance.""" return json.dumps(self, cls=StructEncoder, separators=(",", ":"), sort_keys=True) # Build-up the class namespace dictionary # and use type() to build the result class class_namespace = { "__slots__": (), "_fields": field_names, "__new__": __new__, "__repr__": __repr__, "_asdict": _asdict, "to_json": to_json, } cache = _nt_itemgetters for index, name in enumerate(field_names): try: itemgetter_object = cache[index] except KeyError: itemgetter_object = _itemgetter(index) cache[index] = itemgetter_object class_namespace[name] = property(itemgetter_object) struct_class = type(_TYPENAME, (tuple, ), class_namespace) _CLASS_CACHE[field_names] = struct_class return struct_class
class Point(tuple): 'Point(quantity, price)' __slots__ = () _fields = ('quantity', 'price') def __new__(_cls, quantity, price): 'Create new instance of Point(quantity, price)' if (quantity < 0 or quantity is None): raise ValueError( 'The quantity provided ({}) is an invalid value.'.format( quantity)) if (price < 0 or price is None): raise ValueError( 'The price provided ({}) is an invalid value.'.format(price)) float_quantity = float(quantity) float_price = float(price) return _tuple.__new__(_cls, (float_quantity, float_price)) @classmethod def _make(cls, iterable, new=tuple.__new__, len=len): 'Make a new Point object from a sequence or iterable' result = new(cls, iterable) if len(result) != 2: raise TypeError('Expected 2 arguments, got %d' % len(result)) return result def __repr__(self): 'Return a nicely formatted representation string' return 'Point(quantity=%r, price=%r)' % self def _asdict(self): 'Return a new OrderedDict which maps field names to their values' return OrderedDict(zip(self._fields, self)) def _replace(_self, **kwds): 'Return a new Point object replacing specified fields with new values' result = _self._make(map(kwds.pop, ('quantity', 'price'), _self)) if kwds: raise ValueError('Got unexpected field names: %r' % list(kwds.keys())) return result def __getnewargs__(self): 'Return self as a plain tuple. Used by copy and pickle.' return tuple(self) __dict__ = _property(_asdict) def __getstate__(self): 'Exclude the OrderedDict from pickling' pass def tuppleize(self): return (self.quantity, self.price) quantity = _property(_itemgetter(0), doc='Alias for field number 0') x = _property(_itemgetter(0), doc='Alias for field number 0') price = _property(_itemgetter(1), doc='Alias for field number 1') y = _property(_itemgetter(1), doc='Alias for field number 1')
class Position(tuple): 'Position(top, right, bottom, left)' __slots__ = () _fields = ('top', 'right', 'bottom', 'left') def __new__(_cls, top, right, bottom, left): 'Create new instance of Position(top, right, bottom, left)' return _tuple.__new__(_cls, (top, right, bottom, left)) @classmethod def make(cls, in_iterable, new=tuple.__new__, len=len): """Make a new Position object from a sequence or iterable Parameters --------- in_iterable List of parameters to set position. Rules are same as in CSS (padding, margin, border etc.): - 1 value sets all 4 fields. - 2 values: (first sets top and bottom, 2nd sets left and right) - 3 values: (first sets top, second left/right and third bottom - 4 values: (sets in order: top, right, bottom, left) """ if len(in_iterable) == 1: iterable = itertools.repeat(in_iterable[0], 4) elif len(in_iterable) == 2: iterable = [ in_iterable[0], in_iterable[1], in_iterable[0], in_iterable[1] ] elif len(in_iterable) == 3: iterable = in_iterable + [in_iterable[1]] else: iterable = in_iterable result = new(cls, iterable) if len(result) != 4: raise TypeError('Expected 4 arguments, got %d' % len(result)) return result def _replace(_self, **kwds): 'Return a new Position object replacing specified fields with new values' result = _self._make( map(kwds.pop, ('top', 'right', 'bottom', 'left'), _self)) if kwds: raise ValueError('Got unexpected field names: %r' % list(kwds)) return result def __repr__(self): 'Return a nicely formatted representation string' return self.__class__.__name__ + '(top=%r, right=%r, bottom=%r, left=%r)' % self def _asdict(self): 'Return a new OrderedDict which maps field names to their values.' return collections.OrderedDict(zip(self._fields, self)) def __getnewargs__(self): 'Return self as a plain tuple. Used by copy and pickle.' return tuple(self) top = _property(_itemgetter(0), doc='top margin/padding') right = _property(_itemgetter(1), doc='right margin/padding') bottom = _property(_itemgetter(2), doc='bottom margin/padding') left = _property(_itemgetter(3), doc='left margin/padding')