def setUp(self): """ Prepare the test """ self.sequence = "attgtaggcctgcatgaact" self.seq_with_unknown = "atnntagnnngcatgaact" self.datadir = utility.get_data_directory(__file__)
def setUp(self): """ Prepare the test """ self.sequence = "attgtaggcctgcatgaact" self.seq_with_unknown = "atnntagnnngcatgaact" self.datadir = utility.get_data_directory(__file__)
def setUp(self): """ Prepare the test file """ self.datadir = utility.get_data_directory(__file__) fn = os.path.join(self.datadir,"gene_info_test_file.xls") self.fh = open(fn) self.reader = csv.reader(self.fh, delimiter="\t") self.reader.next() # discard first line
def setUp(self): """ Prepare the test file """ self.datadir = utility.get_data_directory(__file__)
def setUp(self): """ Prepare the test file """ self.datadir = utility.get_data_directory(__file__)