def setUp(self):
"""
Prepare the test
"""
self.sequence = "attgtaggcctgcatgaact"
self.seq_with_unknown = "atnntagnnngcatgaact"
self.datadir = utility.get_data_directory(__file__)
def setUp(self):
"""
Prepare the test
"""
self.sequence = "attgtaggcctgcatgaact"
self.seq_with_unknown = "atnntagnnngcatgaact"
self.datadir = utility.get_data_directory(__file__)
def setUp(self):
""" Prepare the test file """
self.datadir = utility.get_data_directory(__file__)
fn = os.path.join(self.datadir,"gene_info_test_file.xls")
self.fh = open(fn)
self.reader = csv.reader(self.fh, delimiter="\t")
self.reader.next() # discard first line
def setUp(self):
"""
Prepare the test file
"""
self.datadir = utility.get_data_directory(__file__)
def setUp(self):
""" Prepare the test file """
self.datadir = utility.get_data_directory(__file__)
