def test_negative_gc_ratio(self, algorithm):
"""When the user submits a negative GC ratio, they are
shown an error.
"""
with pytest.raises(ValueError) as exc_info:
algorithm(make_seq_record('ATGC'), 2, -1.5, 0.6)
assert (str(exc_info.value) ==
'Invalid GC ratio for ratio between zero and one: -1.5')
def test_greater_than_one_gc_ratio(self, algorithm):
"""When the user submits a GC ratio greater than one, they
are shown an error.
"""
with pytest.raises(ValueError) as exc_info:
algorithm(make_seq_record('ATGC'), 2, 20, 0.6)
assert (str(exc_info.value) ==
'Invalid GC ratio for ratio between zero and one: 20')
def test_single_cpg(self, algorithm):
seq_str = 'CG'
computed = algorithm(make_seq_record(seq_str), 2, 1, 2)
expected = make_algo_results(seq_str, [(0, 2, 1, 2)])
print computed.seq_record.features[0].extract(computed.seq_record.seq)
for a in [computed, expected]:
print a.island_metadata_list[0].gc_ratio
assert computed == expected
def test_single_cpg(self, algorithm):
seq_str = 'CG'
computed = algorithm(make_seq_record(seq_str), 2, 1, 2)
expected = make_algo_results(seq_str, [(0, 2, 1, 2)])
print computed.seq_record.features[0].extract(computed.seq_record.seq)
for a in [computed, expected]:
print a.island_metadata_list[0].gc_ratio
assert computed == expected
def test_negative_gc_ratio(self, algorithm):
"""When the user submits a negative GC ratio, they are
shown an error.
"""
with pytest.raises(ValueError) as exc_info:
algorithm(make_seq_record('ATGC'), 2, -1.5, 0.6)
assert (str(exc_info.value) ==
'Invalid GC ratio for ratio between zero and one: -1.5')
def test_greater_than_one_gc_ratio(self, algorithm):
"""When the user submits a GC ratio greater than one, they
are shown an error.
"""
with pytest.raises(ValueError) as exc_info:
algorithm(make_seq_record('ATGC'), 2, 20, 0.6)
assert (str(exc_info.value) ==
'Invalid GC ratio for ratio between zero and one: 20')
def test_negative_obs_to_exp_ratio(self, algorithm):
"""When the user submits a negative observed-to-expected CpG
ratio, they are shown an error.
"""
with pytest.raises(ValueError) as exc_info:
algorithm(make_seq_record('ATGC'), 2, 0.5, -1.5)
assert (str(exc_info.value) ==
'Invalid observed-to-expected CpG ratio '
'for ratio greater than or equal to zero: -1.5')
def test_negative_obs_to_exp_ratio(self, algorithm):
"""When the user submits a negative observed-to-expected CpG
ratio, they are shown an error.
"""
with pytest.raises(ValueError) as exc_info:
algorithm(make_seq_record('ATGC'), 2, 0.5, -1.5)
assert (str(
exc_info.value) == 'Invalid observed-to-expected CpG ratio '
'for ratio greater than or equal to zero: -1.5')
def test_island_size_less_than_sequence_size(self, algorithm):
"""When the user submits an island size greater than the
sequence size, they are shown an error.
"""
with pytest.raises(ValueError) as exc_info:
algorithm(make_seq_record('ATATGCGC'), 9, 0.5, 0.6)
assert ((str(exc_info.value)) ==
'Island size (9) must be less than or '
'equal to sequence length (8)')
def test_island_size_less_than_sequence_size(self, algorithm):
"""When the user submits an island size greater than the
sequence size, they are shown an error.
"""
with pytest.raises(ValueError) as exc_info:
algorithm(make_seq_record('ATATGCGC'), 9, 0.5, 0.6)
assert ((str(
exc_info.value)) == 'Island size (9) must be less than or '
'equal to sequence length (8)')
def test_set_results_islands_computed_called(self, model):
seq_str = 'ATATCGCGCGCGCATATA'
feature_tuples = [(0, 3), (5, 7), (8, 13)]
seq_record = make_seq_record(seq_str, feature_tuples)
results = AlgoResults(seq_record, [])
callback = MagicMock()
model.islands_computed.append(callback)
model.set_results(results, sentinel.algo_name, sentinel.exec_time)
assert (callback.mock_calls == [
call(seq_str, feature_tuples, sentinel.algo_name,
sentinel.exec_time)
])
def test_get_island_info(self, model):
seq_record = make_seq_record(
'ATATCGCGCGCGCATATA', [(0, 3), (5, 7), (8, 13)])
island_metadata_list = [
IslandMetadata(0.57, 0.89),
IslandMetadata(0.65, 2.13),
IslandMetadata(0.78, 1.3)]
results = AlgoResults(seq_record, island_metadata_list)
model.set_results(results, sentinel.algo_name, sentinel.exec_time)
computed = model.get_island_info(1)
expected = IslandInfo(5, 7, 2, 'GC', 0.65, 2.13)
assert computed == expected
def test_get_island_info(self, model):
seq_record = make_seq_record('ATATCGCGCGCGCATATA', [(0, 3), (5, 7),
(8, 13)])
island_metadata_list = [
IslandMetadata(0.57, 0.89),
IslandMetadata(0.65, 2.13),
IslandMetadata(0.78, 1.3)
]
results = AlgoResults(seq_record, island_metadata_list)
model.set_results(results, sentinel.algo_name, sentinel.exec_time)
computed = model.get_island_info(1)
expected = IslandInfo(5, 7, 2, 'GC', 0.65, 2.13)
assert computed == expected
def test_set_results_islands_computed_called(self, model):
seq_str = 'ATATCGCGCGCGCATATA'
feature_tuples = [(0, 3), (5, 7), (8, 13)]
seq_record = make_seq_record(seq_str, feature_tuples)
results = AlgoResults(seq_record, [])
callback = MagicMock()
model.islands_computed.append(callback)
model.set_results(results, sentinel.algo_name, sentinel.exec_time)
assert (callback.mock_calls ==
[call(seq_str,
feature_tuples,
sentinel.algo_name,
sentinel.exec_time)])
def test_file_loaded_called(self, model):
seq_str = 'ATATGCGCATATA'
with patch('cpg_islands.models.Entrez') as mock_entrez:
with patch('cpg_islands.models.SeqIO') as mock_seqio:
# call previously necessary methods
mock_entrez.read.return_value = {
'IdList': [sentinel._, sentinel._,
sentinel._, sentinel._],
'QueryTranslation': sentinel._}
model.search(sentinel._)
mock_seqio.read.return_value = make_seq_record(seq_str)
model.get_seq_record(2)
model.load_seq()
assert model.seq_input_model.mock_calls == [
call.file_loaded(seq_str)]
def test_user_selected(self, presenter):
seq_str = 'ATATACGCGCATATA'
seq_id = 'NG_032827.2'
seq_desc = "It's a pretty cool sequence"
seq_record = make_seq_record(seq_str)
seq_record.id = seq_id
seq_record.description = seq_desc
presenter.model.get_seq_record.return_value = seq_record
presenter._user_selected(sentinel.index)
assert presenter.model.mock_calls == [
call.get_seq_record(sentinel.index)]
assert presenter.view.mock_calls == [
call.set_seq_locus(
seq_id, 'http://www.ncbi.nlm.nih.gov/nuccore/NG_032827.2'),
call.set_seq_desc(seq_desc),
call.set_seq_len('15 bases'),
call.set_selected_seq(seq_str)]
def test_file_loaded_called(self, model):
seq_str = 'ATATGCGCATATA'
with patch('cpg_islands.models.Entrez') as mock_entrez:
with patch('cpg_islands.models.SeqIO') as mock_seqio:
# call previously necessary methods
mock_entrez.read.return_value = {
'IdList':
[sentinel._, sentinel._, sentinel._, sentinel._],
'QueryTranslation': sentinel._
}
model.search(sentinel._)
mock_seqio.read.return_value = make_seq_record(seq_str)
model.get_seq_record(2)
model.load_seq()
assert model.seq_input_model.mock_calls == [
call.file_loaded(seq_str)
]
def test_user_selected(self, presenter):
seq_str = 'ATATACGCGCATATA'
seq_id = 'NG_032827.2'
seq_desc = "It's a pretty cool sequence"
seq_record = make_seq_record(seq_str)
seq_record.id = seq_id
seq_record.description = seq_desc
presenter.model.get_seq_record.return_value = seq_record
presenter._user_selected(sentinel.index)
assert presenter.model.mock_calls == [
call.get_seq_record(sentinel.index)
]
assert presenter.view.mock_calls == [
call.set_seq_locus(
seq_id, 'http://www.ncbi.nlm.nih.gov/nuccore/NG_032827.2'),
call.set_seq_desc(seq_desc),
call.set_seq_len('15 bases'),
call.set_selected_seq(seq_str)
]
def test_zero_gc_ratio(self, algorithm):
"""The user can submit a GC ratio of zero."""
algorithm(make_seq_record('ATCG'), 2, 0, 0.6)
def test_island_at_end(self, algorithm):
seq_str = 'GCATAACGGTAATCTATCGTATCATATT'
computed = algorithm(make_seq_record(seq_str), 2, 0.5, 0.6)
expected = make_algo_results(seq_str, [(6, 12, 0.5, 3),
(17, 21, 0.5, 4)])
assert computed == expected
def test_island_at_end(self, algorithm):
seq_str = 'ATATATTATTCAACGAGG'
computed = algorithm(make_seq_record(seq_str), 5, 0.5, 0.6)
expected = make_algo_results(seq_str, [(10, 18, 0.625, 4 / 3)])
assert computed == expected
def test_zero_gc_ratio(self, algorithm):
"""The user can submit a GC ratio of zero."""
algorithm(make_seq_record('ATCG'), 2, 0, 0.6)
def test_negative_island_size(self, algorithm):
with pytest.raises(ValueError) as exc_info:
algorithm(make_seq_record(''), -1, 0, 0.6)
assert str(exc_info.value) == 'Invalid island size: -1'
def test_island_at_beginning(self, algorithm):
seq_str = 'CGGATATATA'
computed = algorithm(make_seq_record(seq_str), 3, 0.5, 0.6)
expected = make_algo_results(seq_str, [(0, 6, 0.5, 3)])
assert computed == expected
def test_greater_than_one_obs_to_exp_ratio(self, algorithm):
"""The user can submit an observed-to-expected CpG ratio
greater than one.
"""
algorithm(make_seq_record('ATGC'), 2, 0.5, 1.5)
def test_island_in_middle(self, algorithm):
seq_str = 'ATATACACGGAATATT'
computed = algorithm(make_seq_record(seq_str), 4, 0.5, 0.6)
expected = make_algo_results(seq_str, [(5, 13, 0.5, 2)])
assert computed == expected
def test_island_at_end(self, algorithm):
seq_str = 'ATATATTATTCAACGAGG'
computed = algorithm(make_seq_record(seq_str), 5, 0.5, 0.6)
expected = make_algo_results(seq_str, [(10, 18, 0.625, 4 / 3)])
assert computed == expected
def test_empty_sequence(self, algorithm):
with pytest.raises(ValueError) as exc_info:
algorithm(make_seq_record(''), 1, 0, 0)
assert (str(exc_info.value) == 'Island size (1) must be less than or '
'equal to sequence length (0)')
def test_island_at_beginning(self, algorithm):
seq_str = 'CGGATATATA'
computed = algorithm(make_seq_record(seq_str), 3, 0.5, 0.6)
expected = make_algo_results(seq_str, [(0, 6, 0.5, 3)])
assert computed == expected
def test_zero_island_size(self, algorithm):
with pytest.raises(ValueError) as exc_info:
algorithm(make_seq_record(''), 0, 0, 0)
# exc_info.value returns the actual exception
assert str(exc_info.value) == 'Invalid island size: 0'
def test_greater_than_one_obs_to_exp_ratio(self, algorithm):
"""The user can submit an observed-to-expected CpG ratio
greater than one.
"""
algorithm(make_seq_record('ATGC'), 2, 0.5, 1.5)
def test_negative_island_size(self, algorithm):
with pytest.raises(ValueError) as exc_info:
algorithm(make_seq_record(''), -1, 0, 0.6)
assert str(exc_info.value) == 'Invalid island size: -1'
def test_one_gc_ratio(self, algorithm):
"""The user can submit a GC ratio of one."""
algorithm(make_seq_record('ATCG'), 2, 1, 0.6)
def test_island_at_end(self, algorithm):
seq_str = 'GCATAACGGTAATCTATCGTATCATATT'
computed = algorithm(make_seq_record(seq_str), 2, 0.5, 0.6)
expected = make_algo_results(
seq_str, [(6, 12, 0.5, 3), (17, 21, 0.5, 4)])
assert computed == expected
def test_island_in_middle(self, algorithm):
seq_str = 'ATATACACGGAATATT'
computed = algorithm(make_seq_record(seq_str), 4, 0.5, 0.6)
expected = make_algo_results(seq_str, [(5, 13, 0.5, 2)])
assert computed == expected
def test_empty_sequence(self, algorithm):
with pytest.raises(ValueError) as exc_info:
algorithm(make_seq_record(''), 1, 0, 0)
assert (str(exc_info.value) ==
'Island size (1) must be less than or '
'equal to sequence length (0)')
def test_zero_obs_to_exp_ratio(self, algorithm):
"""The user can submit an observed-to-expected CpG ratio of zero."""
algorithm(make_seq_record('ATGC'), 2, 0.5, 0)
def test_zero_island_size(self, algorithm):
with pytest.raises(ValueError) as exc_info:
algorithm(make_seq_record(''), 0, 0, 0)
# exc_info.value returns the actual exception
assert str(exc_info.value) == 'Invalid island size: 0'
def test_zero_obs_to_exp_ratio(self, algorithm):
"""The user can submit an observed-to-expected CpG ratio of zero."""
algorithm(make_seq_record('ATGC'), 2, 0.5, 0)
def test_one_gc_ratio(self, algorithm):
"""The user can submit a GC ratio of one."""
algorithm(make_seq_record('ATCG'), 2, 1, 0.6)
