# print trans
# if str(trans) == str(TolC):
# print 'congrats, you reinvented the wheel'
# else:
# print 'you still suck'
def reverse_translate_amino_acid(self, amino_acid):
codon_options = self.amino_acid_to_codon_map[amino_acid]
# Somehow make a choice. For now, just first one.
codon = codon_options[0]
# Return the one we chose.
return codon
if __name__ == '__main__':
my_codon_table = CodonTable('standard_usage.txt')
print my_codon_table.translate_codon('AAA')
print my_codon_table.translate_sequence('ATGAAGAAATTGCTCCCCATT')
#print len(my_codon_table.codon_to_amino_acid_map)
#print my_codon_table.amino_acid_to_codon_map
#print len(my_codon_table.amino_acid_to_codon_map)
#print my_codon_table.amino_acid_to_codon_map['A']
#print my_codon_table.amino_acid_to_weight_map
#print my_codon_table.translate_codon('AAA')
#print my_codon_table.reverse_translate_amino_acid('F')
#my_second_codon_table = CodonTable('weird_usage.txt')
def run_script(args):
#open the input file, which should be args.scriptinput
#send to the correct function based on the choice
# print args.scriptinput
scriptinput = open(args.scriptinput[0])
outputfh = open(args.output[0],'w')
output = csv.writer(outputfh)#output.txt','w')
my_codon_table = CodonTable('rEcoli-codon-usage.txt')
my_rare_codon_table = CodonTable('rEcoli-codon-usage-1st20.txt')
scriptinputreader = csv.reader(scriptinput)
if args.mode[0] == 'translate':
for row in scriptinputreader:
line = row[1]
# print line
codonseq = ''
ti = 0
line = line.replace('T','U')
while ti + 2 < len(line):
codon = line[ti] + line[ti+1] + line[ti+2]
codonseq += my_codon_table.translate_codon(codon)
ti += 3
output.writerow([row[0]] + [codonseq])
elif args.mode[0] == 'revtranslate':
for row in scriptinputreader:
line = row[1]
# print line
codonseq = ''
ti = 0
for character in line:
if ti < 20:
table = my_rare_codon_table
else:
table = my_codon_table
codonseq += table.reverse_translate_codon(character)
ti += 1
#print ti
codonseq = codonseq.replace('U','T')
output.writerow([row[0]] + [codonseq])
elif args.mode[0] == 'transcribe':
for row in scriptinputreader:
line = row[1]
# print line
codonseq = ''
codonseq = line.replace('T','U')
output.writerow([row[0]] + [codonseq])
# else:
# print args.mode
elif args.mode[0] == 'calCUT':
calCUT = {}
for row in scriptinputreader:
line = row[1]
ti = 0
while ti + 2 < len(line):
codon = line[ti] + line[ti+1] + line[ti+2]
#print codon
if not codon in calCUT:
calCUT[codon] = 0
calCUT[codon] += 1
ti += 3
#print ti
for codon in calCUT:
count = calCUT[codon]
cudun = codon.replace('T','U')
AA = my_codon_table.translate_codon(cudun)
output.writerow([codon] + [AA] + [count])
# print codonseq
# if str(codonseq) == str(TolC):
# print "nice"
# else:
# print "you suck"
outputfh.close()
