def getPrimerSeqs(dataInfo): primerSeqs = [] for i, val in enumerate(dataInfo['prm_seq']): leftSeq = prep.getFastaSequence(dataInfo['genome_build'][0], dataInfo['vp_chr'][0], dataInfo['prm_start'][i] - 300, dataInfo['prm_end'][i]).upper() leftIndex = leftSeq.rfind(dataInfo['re_seq'][0]) leftPrimerSeq = Seq( leftSeq[leftIndex:]).reverse_complement().tostring() rightSeq = prep.getFastaSequence(dataInfo['genome_build'][0], dataInfo['vp_chr'][0], dataInfo['prm_start'][i], dataInfo['prm_end'][i] + 300).upper() rightIndex = rightSeq.find(dataInfo['re_seq'][0]) + len( dataInfo['re_seq'][0]) rightPrimerSeq = rightSeq[:rightIndex] assert max( leftPrimerSeq.find(dataInfo['prm_seq'][i]), rightPrimerSeq.find(dataInfo['prm_seq'][i]) ) >= 0, 'Primer sequence is wrong\n' + str(dataInfo['prm_seq'][i]) assert min( leftPrimerSeq.find(dataInfo['prm_seq'][i]), rightPrimerSeq.find(dataInfo['prm_seq'][i]) ) <= 0, 'Primer sequence is ambigious\n' + str(dataInfo['prm_seq'][i]) if rightPrimerSeq.find(dataInfo['prm_seq'][i]) >= 0: primerSeqs.append(rightPrimerSeq) else: primerSeqs.append(leftPrimerSeq) return primerSeqs
def find_coding_sequences(dna_sequence, amino_sequence): codon_list = [] i = 0 rna_sequences = [] # First get the codons that code for each amino acids for aa in amino_sequence: codons = ReverseGeneticCode[aa.upper()] codon_list.append(ReverseGeneticCode[aa.upper()]) i += 1 # Then make the combinations of these codons nr_aminoacids = len(codon_list) rna_list = codon_list[0] for i in range(1, nr_aminoacids): rna_list = add_next_level(rna_list, codon_list[i]) # Now change the found RNA sequences into DNA sequences dna_sequences = [] for rna in rna_list: str1 = rna.replace('U', 'T') dna_sequences.append(str1) # Then see if you can find it in the given DNA sequence myseq = Seq(dna_sequence, IUPAC.unambiguous_dna) for dna in dna_sequences: if myseq.find(dna) != -1: print(f'Found {dna}') # Then see if you can find it in the reverse complement DNA sequence myseq = myseq.reverse_complement() for dna in dna_sequences: if myseq.find(dna) != -1: print(f'Found {dna}')
def def_extract(rootdir, file_name_list, fwd_primer, rev_primer, limit): """ Extracts the DNA sequence inserts based on 3' and 5' primer recognition sequences """ print "def_extract" #Extraction primer dictionary (NEEDS TO BE DELETED BEFORE PUBLICATION) stat_extract_dict = {} rc_primer = str(Seq(rev_primer).reverse_complement()) #Opening input files and creating output files if not os.path.exists(rootdir + "/DNA"): os.makedirs(rootdir + "/DNA") for filenames in file_name_list: print filenames sequences = open(rootdir + "/DEMULTIPLEXED/" + filenames, "rU") output = open(rootdir + "/DNA/" + filenames.strip(".csv") + "-DNA.csv","w") stat_extract_dict[filenames] = 0 #Searching primers for i,line in enumerate(sequences): #enumerate: adds a counter to each element (i is the line number in this case) start = 0 end = 0 if line.find(rc_primer) > 0: line = Seq(line).reverse_complement() start = line.find(fwd_primer) end = line.find(rev_primer) extract = str(line[start + len(fwd_primer):end]) #Extracting inserts if start >= 0 and end >= 0: #if len(extract) >= limit_low: output.write (extract) output.write("\n") stat_extract_dict[filenames] += 1 #if i == limit: #break output.close() sequences.close() #Extraction Statisitcs if not os.path.exists(rootdir + "/STATISTICS"): os.makedirs(rootdir + "/STATISTICS") stat = open(rootdir + "/STATISTICS/" + "Statistics-extract.txt","w") stat.write("\t DNA extracted \n") for k, v in stat_extract_dict.iteritems(): stat.write(str(k)) stat.write("\t") stat.write(str(v)) stat.write("\n") stat.close()
def test_seq(): print(f'\n\n{Bio.__version__}') myseq = Seq("GATCGAAATGGGCCTAAAAATATAGGATCGAAAATCGC", IUPAC.unambiguous_dna) print(myseq.alphabet) print(myseq) print(myseq.__len__()) # You can calculate the GC ratio yourself or you can you use a special function to do so print(f'The number of G\'s is: {myseq.count("G")}') print(f'The number of C\'s is: {myseq.count("C")}') print(100 * (myseq.count("G") + myseq.count("C")) / myseq.__len__()) print(f'The ratio GC in the string is: {GC(myseq)}') # Sequences can be inverted and complemented print(f'The string is:\t\t\t\t {myseq}') print(f'The reverse is:\t\t\t\t {myseq[::-1]}') print(f'The complement is:\t\t\t {myseq.complement()}') print(f'The reverse complement is:\t {myseq.reverse_complement()}') # A simple function to determine if a string is palindromic print(f'GAAG is palindrome: {ispalindromic("GAAG")}') print(f'GAAG is palindrome: {ispalindromic("GTAG")}') # Find all the sequences of AAA # Start with the first AAA and that start looping positions = [] pos = myseq.find('AAA') while pos != -1: positions.append(pos) pos = myseq.find('AAA', pos + 1) print(positions) count = len(positions) # A demo to show that Seq is not mutable. # If you need to change a Seq, make it mutable first try: myseq[0] = 'C' except: print("Oops! As Seq is immutable ") im_seq = myseq.tomutable() im_seq[0] = 'C' seq = im_seq print(seq)
def transextend(self, filepath, temppath, revcom): searchseed = self.transcript[self.kbegin:self.kend] aln1 = self.transcript.find(searchseed) txfound = 0 # must have single line fastas to work - no n60 splitting; otherwise, can't use grep for max speed with open(temppath + '/temp','w') as tempfile: if revcom == True: grep = subprocess.Popen(['grep', '-B1', str(searchseed.reverse_complement()), filepath],stdout=tempfile) else: grep = subprocess.Popen(['grep', '-B1', str(searchseed), filepath],stdout=tempfile) grep.wait() tempfile.flush() with open(temppath + '/temp','r') as tempfile: line1='' line2='' for line in tempfile: line1=line2 line2=line.rstrip('\n') if ">" in line1: seqid = line1[1:] if revcom == True: seqread = Seq(line2,generic_dna).reverse_complement() else: seqread = Seq(line2,generic_dna) if seqid not in self.ids: aln2 = seqread.find(searchseed) self.reads.append(seqread) self.ids.append(seqid) self.aligns.append(aln1-aln2) self.ends.append(aln1-aln2+len(seqread)) txfound += 1 return txfound
def NoStop(input_file_path, out_name): """NoStop removes stop codons (that are hard coded in the function; change based on taxa/phyla). Function takes an input "file/path" and a "suffix" which is appended to the infile name.""" codon_stop_array = ["TGA", "TAG", "TAA", "UGA", "UAA", "UAG"] #input_file_path = "/Users/chriswirth/Desktop/PruinescenceSeqs/CAD/CAD_Mod/CAD_AllData_mod.fasta" file_ext = os.path.basename(input_file_path) file, ext = os.path.splitext(file_ext) #NB/caution: Assumes sequences are in frame! for record in SeqIO.parse(input_file_path, "fasta", generic_alphabet): temp_seq = Seq("", generic_alphabet) for index in range(0, len(record.seq), 3): codon = record.seq[index:index + 3] if codon in codon_stop_array: codon = UnknownSeq(3, character='?') #Note += syntax here temp_seq += codon #Write output to a .fasta file, note format fasta_format_string = (">%s\n%s" % (record.name, temp_seq)) a = open("%s_%s.fasta" % (file, out_name), "a+") print >> a, fasta_format_string a.close() #Write change log to a .txt file; could record issues/changes across all "genes" if desired, but I've restricted to only a single AllData file for now b = open("%s_log.csv" % file, "a+") # Prints CSV with path and filename, taxon name, number of stop codons, and position (-1 if none, can be cleaned up easily) of first stop codon print >> b, file, ",", record.name, ",", temp_seq.count( "???"), ",", temp_seq.find("???") b.close() return
def find_frameshift(desired_protein: Seq, orfs: list, g_sequence: Seq) -> tuple: start_index = 0 for orf in orfs: if orf == desired_protein: start_index = g_sequence.find(orf) print(start_index) break return g_sequence[start_index-60:]
def getPrimerSeqs(dataInfo): """ Function to check the primer sequences. Checks wether a sequence occurs in the target region and is unique enough. :param dataInfo: The settings dictionary created by loading the ini. :returns: The provided sequences, both forward and reverse versions. :TODO: Improve error message on faulty primes sequences """ primerSeqs = [] for i, val in enumerate(dataInfo['prm_seq']): leftSeq = prep.getFastaSequence(dataInfo['genome_build'][0], dataInfo['vp_chr'][0], dataInfo['prm_start'][i] - 300, dataInfo['prm_end'][i]).upper() leftIndex = leftSeq.rfind(dataInfo['re_seq'][0]) leftPrimerSeq = Seq( leftSeq[leftIndex:]).reverse_complement().tostring() rightSeq = prep.getFastaSequence(dataInfo['genome_build'][0], dataInfo['vp_chr'][0], dataInfo['prm_start'][i], dataInfo['prm_end'][i] + 300).upper() rightIndex = rightSeq.find(dataInfo['re_seq'][0]) + len( dataInfo['re_seq'][0]) rightPrimerSeq = rightSeq[:rightIndex] assert max( leftPrimerSeq.find(dataInfo['prm_seq'][i]), rightPrimerSeq.find(dataInfo['prm_seq'][i]) ) >= 0, 'Primer sequence is wrong\n' + str(dataInfo['prm_seq'][i]) assert min( leftPrimerSeq.find(dataInfo['prm_seq'][i]), rightPrimerSeq.find(dataInfo['prm_seq'][i]) ) <= 0, 'Primer sequence is ambigious\n' + str(dataInfo['prm_seq'][i]) if rightPrimerSeq.find(dataInfo['prm_seq'][i]) >= 0: primerSeqs.append(rightPrimerSeq) else: primerSeqs.append(leftPrimerSeq) return primerSeqs
def find_sequence(self, sequence_to_find): sequence_obj = Seq(self.sequence, generic_dna) reverse_comp = sequence_obj.reverse_complement() matches = [] # search for exact matches of the consensus sequence pos = sequence_obj.find(sequence_to_find) while (pos >= 0): # got a hit, record position and matching sequence matches.append((pos, sequence_to_find, '+')) pos = sequence_obj.find(sequence_to_find, pos+1) # also, look for matches on the complementary strand pos = reverse_comp.find(sequence_to_find) while (pos >= 0): # got a hit, record position and sequence matches.append((pos, sequence_to_find, '-')) pos = reverse_comp.find(sequence_to_find, pos + 1) return matches
def main(*args, **kwargs): fpath = os.path.join(os.getcwd(),args[-1]) s,t = StrongHold.two_dna(fpath) s,t = Seq(s),Seq(t) idx = 0 start=0 while idx!=-1: idx = s.find(t, start=start) start = idx+1 if idx!=-1: print idx+1,
def manage_protein(data): sequence = Seq(data.sequence, IUPAC.protein) treated_data = Processed_protein( creation_date=data.creation_date.strftime( "%d/%m/%Y, %H:%M:%S UTC"), translation_table=data.translation_table, protein=str(sequence), protein_to_stop=str(sequence) if "*" not in sequence else sequence[0:sequence.find("*")]) return Sequencer.extract_sequence_data(treated_data)
def translate(DNA): candidates = [] for i in range(3, len(DNA)): if DNA[i - 3:i] == 'ATG': # print(i, DNA[i-3:]) candidate = Seq(DNA[i - 3:], IUPAC.unambiguous_dna).translate() p = candidate.find('*') if p != -1: candidate = str(candidate)[:p] candidates.append(candidate) DNA_rev = reverse_complement(DNA) for i in range(3, len(DNA)): if DNA_rev[i - 3:i] == 'ATG': # print(DNA[i-3:]) candidate = Seq(DNA_rev[i - 3:], IUPAC.unambiguous_dna).translate() p = candidate.find('*') if p != -1: candidate = str(candidate)[:p] candidates.append(candidate) return '\n'.join(list(set(candidates)))
def find_all(seq: Seq, residue: str, \ start_index: int, end_slice: int) -> Tuple[Optional[int], ...]: """Search for a residue and return a list of positions for each frame""" positions = list() start = start_index end = end_slice while start < end: position = seq.find(residue, start, end) if position == -1: break positions.append(position) start = position + 1 return tuple(positions)
def extract_amino_acid_position(df, record_dict, pep_idx): """ Make lists of the column values for protein id sequence and topology loops through searching and extracting amino acid position number using Biopython Seq.find(). Finally adds the position to the topology to get AbsPos1 and Abspos2 for both peptides and creates a new DF column. This function is called internally by get_seq_id(). """ protein = list(df['prot%s' % pep_idx]) xl = list(df['seq%s' % pep_idx]) top = list(df['top%s' % pep_idx].apply(pd.to_numeric)) AbsPos = [] for i, prot in enumerate(protein): my_seq = Seq(str(record_dict[prot].seq)) pos = my_seq.find(xl[i]) AbsPos.append(pos + top[i]) df['AbsPos%s' % pep_idx] = AbsPos
def find(self, sub, start=0, end=_sys.maxsize): """This method behaves like the python string method of the same name. Returns an integer, the index of the first occurrence of substring argument sub in the (sub)sequence given by [start:end]. Returns -1 if the subsequence is NOT found. Parameters ---------- sub : string or Seq object a string or another Seq object to look for. start : int, optional slice start. end : int, optional slice end. Examples -------- >>> from pydna.dseq import Dseq >>> seq = Dseq("atcgactgacgtgtt") >>> seq Dseq(-15) atcgactgacgtgtt tagctgactgcacaa >>> seq.find("gac") 3 >>> seq = Dseq(watson="agt",crick="actta",ovhg=-2) >>> seq Dseq(-7) agt attca >>> seq.find("taa") 2 """ if self.linear: return _Seq.find(self, sub, start, end) sub_str = self._get_seq_str_and_check_alphabet(sub) return (_pretty_str(self) + _pretty_str(self)).find( sub_str, start, end)
def trans_RF(start,strand): rf = Seq(strand[start:]) if len(rf) % 3 == 2: rf = str(rf) rf = rf + 'N' rf = Seq(rf) elif len(rf) % 3 == 1: rf = str(rf) rf = rf + 'NN' rf = Seq(rf) rf = rf.translate() rf = str(rf) j = rf.find('*') if j!= -1 and rf[0:1] == 'M': reading_frames.append(rf[:j])
def checkhex(seq, dorev): # Will look on the revcomp of seq if dorev==True seq = Seq(seq) if dorev: seq = seq.reverse_complement() #print "Checking seq: " + seq hexes = [ "AATAAA", "ATTAAA", "AGTAAA", "TATAAA", "CATAAA", "GATAAA", "AATATA", "AATACA", "AATAGA", "AATGAA", "ACTAAA", "AACAAA", "TTTAAA" ] out = "NONE" for checkhex in hexes: if seq.find(checkhex) > -1: out = checkhex break #print "Found hex: " + out return out
from Bio.Seq import Seq tatabox_seq = Seq("tataaaggcAATATGCAGTAG") start_idx = tatabox_seq.find("ATG") end_idx = tatabox_seq.find("TAG", start_idx) orf = tatabox_seq[start_idx:end_idx + 3] print(orf)
import numpy as np import pandas as pd import Bio from Bio.Seq import Seq from Bio import SeqIO from Bio.SeqRecord import SeqRecord from Bio.Alphabet import generic_dna from Bio.SeqUtils import GC #Given two strings s and t, t is a substring of s if t is contained as a contiguous collection of symbols in s (as a result, t must be no longer than s). s = Seq("TGAGAAGTAGGAGCAAGCAGCTTGCAAGCAGCCCCAAGCAGGACAAGCAGCAAGCAGCCAAGCAGGACAAGCAGTAAGCTCAAGCAGGGCAAGCAGACAAGCAGGAGAAGACAAGCAGCCATGCACAAGCAGCAAGCAGACCTGCAAGCAGCAAGCAGCTCAAGCAGTTAATCAAGCAGCAAGCAGCAAGCAGATCAAGCAGTCACAGATCGGACAAGCAGTTTGCAAGCAGCAAGCAGACAAGCAGCCTCAAGCAGCAAGCAGCTTCAAGCAGTGTACAAGCAGTTACCAAGCAGATCCATATCAAGCAGGGCACAAGCAGACCCAGAGTCAAGCAGGAATCAAGCAGCCAAGCAGCAAGCAGCAAGCAGTACAAGCAGCAAGCAGCAAGCAGCCAAGCAGTTCCAAGCAGCAAGCAGGGTAAGTGTCAAGCAGCAAGCAGGGTGCAGCAAGCAGTGCAAGCAGCAAGCAGCCCAAGCAGCAAGCAGCCAAGCAGCTCCCAAGCAGCCAAGCAGCAACAAGCAGAAGATCAAGCAGTGCCGCAAGCAGCATCCTTCAAGCAGACCAAGCAGCTCCACAAGCAGTATAGGGGGGGAGGCAAGCAGAAGGTCAAGCAGTCAAGCAGCGCACCCAAGCAGAAGCAAGCAGACAAGCAGCAAGCAGACAAGCAGTCAAGCAGACCAAGCAGAGCAAGCAGCCAAGCAGTCCCCAAGCAGACAAGCAGAGTCCCGTTCCAAGCAGGAAACAAGCAGCAAGCAGCAAGCAGTAAAGTCCCACAAGCAGGTTCCAAGCAGCAAGCAGCAACAAGCAGTGGCAAGCAGACAAGCAGTTCCAAGCAGCAAGCAG") t = Seq("CAAGCAGCA") locations = [] count = 0 loc = 0 while (count < len(s)): loc = s.find(t, start=count) if (loc > 0): count = loc + 1 # adding plus 1 since the result needs to be in count from 1 format locations.append(loc + 1) else: count = count + 1 print(' '.join(map(str, locations)))
preseq = "YYC" postseq = "WGQ" filein = open(sys.argv[1]) fileout = open(sys.argv[2], "w") linecount = 0 for line in filein: linecount += 1 if linecount % 2 == 1: header = line.rstrip() fastaheader = header.replace("@", ">") else: sequence = Seq(line.rstrip()) startaa = sequence.find(preseq) + 3 endaa = sequence.find(postseq) if startaa == -1 or endaa == -1: continue targetbit = line.rstrip()[startaa:endaa] if targetbit in bigset or len(targetbit) > 50 or len(targetbit) < 1: continue bigset.add(targetbit) fileout.write(fastaheader + "\n") fileout.write(targetbit + "\n") filein.close() fileout.close() #print("Got total number of CDR3s: "+str(len(bigset)))
startseq = "ATGGCACAG" endseq = "ACCGTCTCCTCA" readsread = 0 readspassing = 0 linecounter = 0 for line in filein: linecounter += 1 if linecounter % 4 == 1: readsread += 1 headerline = line if linecounter % 4 == 2: dna = Seq(line.rstrip()) startbase = dna.find(startseq) endbase = dna.find(endseq) if startbase == -1 or endbase == -1: #read fails if missing the start or end sequence continue targetregion = Seq(line.rstrip()[startbase:endbase + 1 + len(endseq)], generic_dna) if len( str(targetregion) ) % 3 != 0: #read fails if the grabbed region is not a multiple of three continue translated = targetregion.translate() if "*" in str(translated): #read fails if it has a stop codon continue readspassing += 1 fileout.write(headerline) fileout.write(str(translated) + "\n")
data4r = data4[::-1] pos = record.POS #Base positions in trace files posr = pos[::-1] #Reverse base positions print file_name # gk loop in order to batch process all mutations n = -1 for gklist in mutation: n+=1 # counter # Query sequence variables gkf = Seq(gklist[1].upper()) # million mutation project gk allele forward sequence 20 bp before mutation WTf = Seq(gklist[2].upper()) # wild type nucleotide at mutation site # Find sequence lgkf = seq.find(gkf) # lgkf = location of gkf in input file str1 lgkr = rseq.find(gkf) # lgkr = location of gkr in input file str1 # Display results if lgkf >= 0: print_details(file_name,data1,data2,data3,data4,phd,WTf,lgkf,gkf,fwo,pos) continue elif lgkr >= 0: gkr = gkn.reversecomplement() gkr_ = gkr[n] gkrF = gkr_[1:20] WTrF = gkr_[0] lgkrF = seq.find(gkrF) if lgkrF >= 0: print_rdetails(file_name,data1,data2,data3,data4,phd,WTrF,lgkrF,fwo) continue
Similarly, an error will be thrown if you try to do something like translate a protein sequence. """ """ The Seq object has a number of methods which act just like those of a Python string (For example, the find and count methods). """ #rom Bio.Seq import Seq #from Bio.Alphabet import generic_dna my_dna = Seq("AGTACACTGGT", generic_dna) print my_dna #Seq('AGTACACTGGT', DNAAlphabet()) my_dna.find("ACT") #5 my_dna.find("TAG") #-1 my_dna.count("GG") #note that count is non-overlapping "AAAAAAA".count("AA") """ BioPython has several built-in functions for biological applications: complement, reverse complement, translation, back translation """ #from Bio.Seq import Seq #from Bio.Alphabet import generic_dna
class HrTemplate: """Holds information about a template for homologous recombination. Args: seq(Bio.Seq): sequence of the HR template target_location(GenomicLocation): genomic location the template is targeting target(Bio.Seq): Entire sequence of the targeted site frame(int): can be +1, +2, +3, -1, -2, -3, or 0 (non-coding) """ def __init__(self, seq): # instance variables self.seq = Seq(str(seq), generic_dna) # sequence of the hr template itself self.target_site = None # GenomicLocation object self.target = None # genomic sequence of the region this template targets (not necessarily identical to seq of template) self.frame = 1 # can be +1, +2, +3, -1, -2, -3, or 0 (non-coding) def __eq__(self, other): return (( self.seq, self.target_location, self.target, self.frame ) == (other.seq, other.target_location, other.target, other.frame )) def __ne__(self, other): return not self == other def find_frame(self): #assume that protein seq with fewest number of stops is correct revcomp = self.seq.reverse_complement() forward_stops = [] reverse_stops = [] min_stops = 1000 for i in range(3): #print self.seq[i:].translate() #print revcomp[i:].translate() #print forward_stops = self.seq[i:].translate().count("*") reverse_stops = revcomp[i:].translate().count("*") if forward_stops < min_stops: self.frame = i+1 min_stops = forward_stops if reverse_stops < min_stops: self.frame = (-1*i)-1 min_stops = reverse_stops def remove_pam( self, sgrna ): # find location based on genomic sequence we're targeting # then perform mutation based on existing HR template # this allows mutations in HR template, serial removal of multiple PAMs, etc. protospacer = sgrna.protospacer.back_transcribe() sgrna_target_index = self.target.seq.find( protospacer ) # where are we in the whole target sequence? sgrna_template_index = self.seq.find( protospacer ) # where are we in the HDR template? if sgrna_template_index != -1 and sgrna_target_index != -1: strand = "+" else: strand = "-" sgrna_target_index = self.target.seq.find(protospacer.reverse_complement()) sgrna_template_index = self.seq.find(protospacer.reverse_complement()) if sgrna_target_index != -1 and sgrna_template_index == -1: # this can only happen if the introduced mutation ablates the protospacer print "Could not find protospacer in HR template sequence. Mutation ablated protospacer or protospacer lies in the ablated PAM of another guide." return True elif sgrna_target_index == -1 and sgrna_template_index == -1: # Should never get here, if sgrna_template_index is != -1 print "Could not find protospacer in HR target sequence!" return False # print "Strand %s" % strand if strand == "+": possible_bases3 = ["A", "T", "C"] # 3rd base of pam possible_bases2 = ["T", "C" ] # 2nd base of pam template_pos2,template_pos3 = range(sgrna_template_index + len(protospacer)+1, sgrna_template_index + len(protospacer)+3) # only get the last 2 bases of the PAM target_pos2,target_pos3 = range(sgrna_target_index + len(protospacer)+1, sgrna_target_index + len(protospacer)+3) # only get the last 2 bases of the PAM else: possible_bases3 = ["A", "T", "G"] # 3rd base of pam possible_bases2 = ["A", "G" ] # 2nd base of pam template_pos3, template_pos2 = range(sgrna_template_index-3, sgrna_template_index-1) # only get the last two bases of the PAM target_pos3, target_pos2 = range(sgrna_target_index-3, sgrna_target_index-1) # only get the last two bases of the PAM #print pos2, pos3 # from here on, whether + or - strand, pam_indices order is [pos2,pos3] = 2nd base of PAM, 3rd base of PAM # print pam_indices if self.frame == 0: # if we're in a noncoding region, replace with a randomly allowed base base = random.choice(possible_bases3) seq_copy = self.seq[:template_pos3] + base + self.seq[template_pos3+1:] self.seq = seq_copy return True # SHOULD THE CASE BELOW JUST BE USED EVERY TIME? else: # if we're in a coding region, possible_bases is shuffled and we iterate random.shuffle( possible_bases3 ) random.shuffle( possible_bases3 ) random.shuffle( possible_bases2 ) possible_bases2.insert(0, self.seq[ template_pos2 ] ) # add existing 2nd PAM base to the list. that way we start with identity at pos2 and vary pos3, then move on to varying both ref_translations = [] # TODO work on pam removal if we don't have feature info. if self.target.features == None: if strand == "+": ref_translations.append(str(self.target[abs(self.frame)-1:].translate())) else: ref_translations.append(str(self.target.reverse_complement()[abs(self.frame)-1:].translate())) # we have feature information, e.g. from a genbank file if self.target.features != None: for feature in self.target.features: if feature.type == "CDS": ref_translations.append( str(feature.extract(self.target).seq.translate()) ) for base3 in possible_bases3: for base2 in possible_bases2: if strand == "+": target_copy = self.target[:target_pos2] + base2 + base3 + self.target[target_pos3+1:] # copy of the full target seq with PAM bases replaced else: target_copy = self.target[:target_pos3] + base3 + base2 + self.target[target_pos2+1:] # copy of the full target seq with PAM bases replaced test_translations = [] target_copy.features = self.target.features if target_copy.features == None: # fasta if strand == "+": test_translations.append(str(target_copy[abs(self.frame)-1:].translate())) else: test_translations.append(str(target_copy.reverse_complement()[abs(self.frame)-1:].translate())) else: # genbank for feature in target_copy.features: if feature.type == "CDS": test_translations.append(str(feature.extract(target_copy).seq.translate())) synonymous = set(test_translations).issubset(set(ref_translations)) # are all of the test translations found in the reference translations? if synonymous == True: if strand == "+": self.seq = self.seq[:template_pos2] + base2 + base3 + self.seq[template_pos3+1:] # copy of the HR template seq with PAM bases replaced else: self.seq = self.seq[:template_pos3] + base3 + base2 + self.seq[template_pos2+1:] return True # print protospacer # print test_translation # print ref_translation # print #print "Could not remove PAM!" return False
book = xlrd.open_workbook(xlsfile) sheet = book.sheet_by_index(0) nrows = sheet.nrows #print (nrows) #print (xlsfile) #print sheet.cell_value(rowx=0, colx=2) oligo_row = 0 oligo_col = 2 name_col = 1 for oligo in range(sheet.nrows): cell = sheet.cell_value(rowx=oligo_row, colx=oligo_col) if oligo_row < nrows: oligo_caps = cell.upper() oligo_find = ref_seq.find(oligo_caps) oligo_rev_find = ref_rev_comp.find(oligo_caps) if oligo_find == -1 and oligo_rev_find == -1 or cell == '': oligo_row += 1 elif oligo_find != -1 or oligo_rev_find != -1: #print ('elif1') name = sheet.cell_value(rowx=oligo_row, colx=name_col) name_match_list.extend((name, )) no_match += 1 oligo_row += 1 #print (name) #print (oligo_caps) #print ("GOT IT") print "this is name_match_list % s" % name_match_list
G | GTG V(s)| GCG A | GAG E | GGG G | G --+---------+---------+---------+---------+-- """ # 6 : find ORF from sequence object # from Bio.Seq import Seq PHYB = Seq( "AAAAAAGTCGCAGAAAATATATGAGGAAACAAAAAGCGAAGACGACAAAAAAAAAAAAAACTCTGATTTTTTTTTGTTATCTCTCTCTATCTGAGAGGCACACATTT\ TGCTTCGTCTTCTTCAATTTATTTTATTGGTTTCTCCACTTATCTCCGATCTCAATTCTCCCCATTTTCTTCTTCCTCAAGTTCAAAATTCTTGAGAATTTAGCTCTACCAGAATTCGT\ CTCCGATAACTAGTGGATGATGATTCACCCTAAATCCTTCCTTGTCTCAAGGTAATTCTGAGAAATTTCTCAAATTCAAAATCAAACGGCATGGTTTCCGGAGTCGGGGGTAGTGGCGG\ TGGCCGTGGCGGTGGCCGTGGCGGAGAAGAAGAACCGTCGTCAAGTCACACTCCTAATAACCGAAGAGGAGGAGAACAAGCTCAATCGTCGGGAACGAAATCTCTCAGACCAAGAAGCA\ ACACTGAATCAATGAGCAAAGCAATTCAACAGTACACCGTCGACGCAAGACTCCACGCCGTTTTCGAACAATCCGGCGAATCAGGGAAATCATTCGACTACTCACAATCACTCAAAAC" ) # 582 base from PHYB start_idx = PHYB.find("ATG") end_idx = PHYB.find("TAG", start_idx) # skipped TAA, TGA for convenience orf = PHYB[start_idx:end_idx + 3] print(orf) # ATGAGGAAACAAAAAGCGAAGACGACAAAAAAAAAAAAAACTCTGATTTTTTTTTGTTATCTCTCTCTATCTGAGAGGCACACATTTTGCTTCGTCTTCTTCAATTTATTTT # ATTGGTTTCTCCACTTATCTCCGATCTCAATTCTCCCCATTTTCTTCTTCCTCAAGTTCAAAATTCTTGAGAATTTAG # 7 : Weight of sequence # from Bio.Seq import Seq # from Bio.Alphabet import IUPAC from Bio.SeqUtils import molecular_weight seq1 = Seq("ATGCAGTAG") seq2 = Seq("ATGCAGTAG", IUPAC.unambiguous_dna) seq3 = Seq("ATGCAGTAG", IUPAC.protein)
def ungap ( seq ) : if ( seq.find('-') >= 0 ): seq = Seq ( str(seq).replace('-','')) if ( seq.find('~') >= 0 ): seq = Seq ( str(seq).replace('~','')) return seq
# Check Biopython version Bio.__version__ ## Sequence Operations # Sequence seq = Seq("GGACCTGGAACAGGCTGAACCCTTTATCCACCTCTCTCCAATTATACCTATCATCCTAACTTCTCAGTGGACCTAACAATCTTCTCCCTTCATCTAGCAGGAGTC") # Alphabet seq.alphabet # Check type type(seq.alphabet) # Find sub-sequence: if TRUE <- SubSeq Position, else <- return -1 seq.find("ATC") seq.find("ATGC") # Number of `A` seq.count("A") # Number of `C` seq.count("C") # Number of `T` seq.count("T") # Number of `G` seq.count("G")
def get_new_sequence(dfname, dbname, rna_db, protein_db, dataset_name): version = get_version(protein_db) if (version == 'swissprot'): db = 'sp' else: db = version protein_coding_list = get_protein_coding_list_from_db(protein_db) records = DataIterator(dbname) strand_dict = {} protein_id_dict = {} for record in records: if (record[2] == 'transcript'): if ('transcript_type' in record.attributes): if (record.attributes['transcript_type'][0] == 'protein_coding' ): if (record.attributes['transcript_id'][0] in protein_coding_list): strand_dict[record.attributes['transcript_id'] [0]] = record[6] protein_id_dict[record.attributes['transcript_id'][0]]=(record.attributes['protein_id'][0],\ record.attributes['gene_id'][0]) print("protein_id_dict ready") sequence_dict = {} rna_seqs = SeqIO.parse(rna_db, 'fasta') ##check the correctness of rna-seqs for correct in rna_seqs: tmp = correct.id flag = tmp.find("|") mrna_id = tmp[:flag] tmp = tmp[flag + 1:] cds = tmp.find('CDS:') if (cds == -1): print("The format of file of parameter -r(--rna) is incorrect!") return 0 tmp = tmp[cds:] cds_end = tmp.find('|') tmp = tmp[tmp.find(':') + 1:cds_end] split_flag = tmp.find('-') if (split_flag == -1): print("The format of file of parameter -r(--rna) is incorrect!") return 0 coding_start = int(tmp[:split_flag]) coding_end = int(tmp[split_flag + 1:]) for seq in rna_seqs: tmp = seq.id flag = tmp.find("|") mrna_id = tmp[:flag] tmp = tmp[flag + 1:] cds = tmp.find('CDS:') tmp = tmp[cds:] cds_end = tmp.find('|') tmp = tmp[tmp.find(':') + 1:cds_end] split_flag = tmp.find('-') coding_start = int(tmp[:split_flag]) coding_end = int(tmp[split_flag + 1:]) sequence_dict[mrna_id] = (coding_start, seq.seq, coding_end) print("sequence_dict ready") df = pd.read_csv(dfname, sep='\t', header=None) change_df = extract_transcript_change(df) trans_index_dict = {} for i in range(0, change_df.shape[0]): if (change_df.iloc[i]['mrna'] not in trans_index_dict.keys()): trans_index_dict[change_df.iloc[i]['mrna']] = [i] else: trans_index_dict[change_df.iloc[i]['mrna']].append(i) my_seqs = [] k_cnt = 0 hom_cnt = 0 het_cnt = 0 for k in trans_index_dict.keys(): if (k in protein_id_dict.keys()): k_cnt += 1 # if(k_cnt%1000==0): # print(k_cnt) pid = protein_id_dict[k][0] gid = protein_id_dict[k][1] if (strand_dict[k] == '+'): transcript = str(sequence_dict[k][1]) else: tmp = Seq(str(sequence_dict[k][1]), IUPAC.ambiguous_dna).complement() transcript = str(tmp) coding_start = int(sequence_dict[k][0]) - 1 coding_end = int(sequence_dict[k][2]) - 1 transcript = transcript[coding_start:coding_end + 1] shift = 0 des = "" het_list = [] hom_position_list = [] for i in trans_index_dict[k]: if (change_df.iloc[i]['snp_type'] == 'hom'): hom_cnt += 1 hom_position_list.append( (int(change_df.iloc[i]['c_start']), change_df.iloc[i]['mutation_type'])) # if(change_df.iloc[i]['mutation_type']=='snv'): # transcript=change_seq(transcript,int(change_df.iloc[i]['c_start'])+shift,\ # int(change_df.iloc[i]['c_end'])+shift,change_df.iloc[i]['c_content'],'snv') # des+="snv:"+str(change_df.iloc[i]['c_start'])+change_df.iloc[i]['c_content']+'_' # else: if (strand_dict[k] == '-'): transcript=change_seq(transcript,int(change_df.iloc[i]['c_start'])+shift,\ int(change_df.iloc[i]['c_end'])+shift,str(Seq(str(change_df.iloc[i]['c_content'])).complement()),\ change_df.iloc[i]['mutation_type']) else: transcript=change_seq(transcript,int(change_df.iloc[i]['c_start'])+shift,\ int(change_df.iloc[i]['c_end'])+shift,change_df.iloc[i]['c_content'],\ change_df.iloc[i]['mutation_type']) des+=change_df.iloc[i]['mutation_type']+":"+str(change_df.iloc[i]['c_start'])+'-'+\ str(change_df.iloc[i]['c_end'])+str(change_df.iloc[i]['c_content'])+'_' if (change_df.iloc[i]['mutation_type'].find('del') != -1): shift -= (int(change_df.iloc[i]['c_end']) - int(change_df.iloc[i]['c_start']) + 1) elif (change_df.iloc[i]['mutation_type'].find('ins') != -1): shift += (int(change_df.iloc[i]['c_end']) - int(change_df.iloc[i]['c_start']) + 1) else: het_list.append(i) het_cnt += 1 coding_start = int(sequence_dict[k][0]) + shift - 1 coding_end = int(sequence_dict[k][2]) + shift - 1 count = int(len(transcript) / 900) if (len(transcript) <= 900): count = 1 cnt = 0 for l in range(0, count): l = l * 900 start = l if (start + 1799 < len(transcript)): stop = start + 1799 else: stop = len(transcript) - 1 # while(coding_start>stop): # l=l+1 # start=l*1800 # if(l+1799<len(transcript)): # stop=l+1799 # else: # stop=len(transcript)-1 # #if(start>coding_end+shift) if (len(hom_position_list) != 0): new_sequence = "" new_des = "" for p in hom_position_list: if ((p[0] - 1 >= start) & (p[0] - 1 <= stop)): flag = des.find(str(p[0])) tmp = des[flag:] flag = tmp.find('_') new_des += str(p[1]) + ":" + tmp[:flag + 1] new_sequence = transcript if (len(new_sequence) != 0): new_sequence = new_sequence[start:stop + 1] if (strand_dict[k] == '+'): new_seq = str( Seq(str(new_sequence), IUPAC.ambiguous_dna). transcribe().translate(to_stop=True)) else: new_seq = str( Seq(str(new_sequence), IUPAC.ambiguous_dna).complement(). transcribe().translate(to_stop=True)) cnt += 1 while (new_seq.find('None') != -1): new_seq = new_seq.replace('None', '') my_seqs.append(SeqRecord(Seq(str(new_seq),IUPAC.protein),\ id=db+'|'+pid+'|'+k+'|'+gid+'_'+str(cnt)+':'+str(start+1)+'-'+str(stop+1),\ description=new_des)) het_number = len(het_list) for n in range(0, het_number): new_sequence = "" new_des = "" if ((int(change_df.iloc[het_list[n]]['c_start']) >= start) & (int(change_df.iloc[het_list[n]]['c_start']) <= stop)): if (strand_dict[k] == '-'): new_sequence=change_seq(transcript,int(change_df.iloc[het_list[n]]['c_start'])+shift,\ int(change_df.iloc[het_list[n]]['c_end'])+shift,\ str(Seq(str(change_df.iloc[het_list[n]]['c_content'])).complement()),\ change_df.iloc[het_list[n]]['mutation_type']) else: new_sequence=change_seq(transcript,int(change_df.iloc[het_list[n]]['c_start'])+shift,\ int(change_df.iloc[het_list[n]]['c_end'])+shift,change_df.iloc[het_list[n]]['c_content'],\ change_df.iloc[het_list[n]]['mutation_type']) new_des=des+change_df.iloc[het_list[n]]['mutation_type']+":"+\ str(change_df.iloc[het_list[n]]['c_start'])+'-'+str(change_df.iloc[het_list[n]]['c_end'])+\ str(change_df.iloc[het_list[n]]['c_content']) if (len(new_sequence) != 0): new_sequence = new_sequence[start:stop + 1] if (strand_dict[k] == '+'): new_seq = str( Seq(str(new_sequence), IUPAC.ambiguous_dna). transcribe().translate(to_stop=True)) else: new_seq = str( Seq(str(new_sequence), IUPAC.ambiguous_dna).complement(). transcribe().translate(to_stop=True)) cnt += 1 while (new_seq.find('None') != -1): new_seq = new_seq.replace('None', '') my_seqs.append(SeqRecord(Seq(str(new_seq),IUPAC.protein),\ id=db+'|'+pid+'|'+k+'|'+gid+'_'+str(cnt)+':'+str(start+1)+'-'+str(stop+1),\ description=new_des)) print("The number of proteins related is " + str(k_cnt)) print("The number of sequences generated is " + str(len(my_seqs))) print("The number of homozygous is " + str(hom_cnt)) print("The number of heterozygous is " + str(het_cnt)) #return my_seqs handle = open(dataset_name + "_all_mutation_" + version + ".fasta", "w") hom_seq = 0 het_seq = 0 hom_het_seq = 0 for sequence in my_seqs: if (str(sequence.description)[-1] == '_'): hom_seq += 1 else: if (str(sequence.description).find('_') == -1): het_seq += 1 else: hom_het_seq += 1 SeqIO.write(sequence, handle, "fasta") print("The number of homozygous sequences is " + str(hom_seq)) print("The number of heterozygous sequences is " + str(het_seq)) print("The number of mixed sequences is " + str(hom_het_seq))
linecount += 1 if linecount % 2 == 1: header = line.rstrip() fastaheader = header.replace( "@", ">") + "_S" + args.sample + "_I" + args.immuno + "_B" + args.boost identifier = header.replace("@", "") else: sequence = Seq(line.rstrip()) ## modified pattern search using a motif, i.e. introduced a regex ## meaning the regex itself might not yield any results, so additional ## conditionals need to be introduced before using .find() ## NB: always finds using first regex match ### startaa = sequence.find(preseq) + 3 if len(re.findall(r"T.{2}Y.{1}C", str(sequence))) > 0: startaa = sequence.find( re.findall(r"T.{2}Y.{1}C", str(sequence))[0]) + 3 else: startaa = -1 ### endaa = sequence.find(postseq) if len(re.findall(r".{6}TVSS", str(sequence))) > 0: endaa = sequence.find(re.findall(r".{6}TVSS", str(sequence))[0]) else: endaa = -1 if startaa == -1 or endaa == -1: tsvfile.write(identifier + "\t" + "NA" + "\t" + line.rstrip() + "\tno-cdr3\n") continue targetbit = line.rstrip()[startaa:endaa] if targetbit in bigset or len(targetbit) > 50 or len(targetbit) < 1: tsvfile.write(identifier + "\t" + targetbit + "\t" + line.rstrip() + "\tnon-unique\n")
with open(realize_file, 'r') as fin: # Skip header fin.readline() for line in fin: parsed = line.split(';') v_index = parsed[1] v_index = int(v_index.replace('(', '').replace(')', '')) v_choice.append(v_genes[v_index]) j_index = parsed[2] j_index = int(j_index.replace('(', '').replace(')', '')) j_choice.append(j_genes[j_index]) # Parse the CDR3 file and print clonotype (V gene, J gene, AA CDR3) if: # (a) J gene is inframe # (b) CDR3 anchors are found # (c) Amino acid translation of CDR3 contains no stop codons cdr3_aa = [] with open(cdr3_file, 'r') as fin: # Skip header fin.readline() for line in fin: seq_index, nt_cdr3, anchors_found, is_inframe = line.split(',') seq_index = int(seq_index) anchors_found = int(anchors_found) is_inframe = int(is_inframe) if anchors_found and is_inframe: aa_cdr3 = Seq(nt_cdr3, IUPAC.unambiguous_dna).translate() if aa_cdr3.find('*') == -1: print(v_choice[seq_index], j_choice[seq_index], aa_cdr3)
def search(syn, tag, save=True, output_dir="~", output_name="gRNA"): try: for record in SeqIO.parse(syn, "fasta"): ori_seq = Seq(str(record.seq), IUPAC.unambiguous_dna) rev_com_seq = str(ori_seq.reverse_complement()) except FileNotFoundError: print("Sequence file not found!") except: print("Sequence file error!") try: dic = pd.read_csv(tag, header=0) except FileNotFoundError: print("PCR Tag file not found!") except: print("PCR Tag file error!") total_len = len(ori_seq) foundlist = [] # make WT reference table for idx, row in dic.iterrows(): ori_result = ori_seq.find(row["Forward Syn"]) if ori_result != -1: WT = str(ori_seq[int(ori_result - 25):ori_result] + row['Forward WT'] + ori_seq[int(ori_result + len(row["Forward Syn"])):ori_result + len(row["Forward Syn"]) + 26]) foundlist.append([ row["Amplicon"], int(ori_result - 25), int(ori_result + len(row["Forward Syn"]) + 26), "Forward", WT ]) else: print(idx, row["Forward Syn"], " not found!") com_result = rev_com_seq.find(row["Reverse Syn"]) if com_result != -1: WT = str(rev_com_seq[int(com_result - 25):com_result] + row['Reverse WT'] + rev_com_seq[int(com_result + len(row["Reverse Syn"])):com_result + len(row["Reverse Syn"]) + 26]) foundlist.append([ row["Amplicon"], int(total_len - int(com_result + len(row["Reverse Syn"]) + 26)), int(total_len - int(com_result - 25)), "Reverse", WT ]) else: print(idx, row["Reverse Syn"], " not found!") frames = pd.DataFrame(foundlist, columns=[ 'Amplicon', 'syn_FWD_start', 'syn_FWD_end', 'strand', 'WT_5_to_3' ]) output = [] for idx, row in frames.iterrows(): WT = row['WT_5_to_3'] if row['strand'] == "Forward": seq = ori_seq start = row["syn_FWD_start"] end = row["syn_FWD_end"] elif row['strand'] == "Reverse": seq = rev_com_seq start = total_len - row["syn_FWD_end"] end = total_len - row["syn_FWD_start"] frame = str(seq[start:end]) target = [n.start() for n in re.finditer(".GG", frame)] if len(target) != 0: # make sure NGG exists on syn for f in target: f_abs = f + start if row['strand'] == "Forward": newstart = f_abs - 20 newend = f_abs + 3 elif row['strand'] == "Reverse": newstart = total_len - (f_abs + 3) newend = total_len - (f_abs - 20) else: print( "Deprecated intermediate file at line {}!".format(idx)) exit(1) GGpos = [n.start() for n in re.finditer("GG", WT)] # find GG on WT if len(GGpos) != 0: # GG found on WT ce = 0 ct = 0 for GG in GGpos: eight = WT[GG - 9:GG - 1] # get -8 to -1 if eight == str(seq[f_abs - 8:f_abs]): # -8 to -1 same twelve = WT[GG - 21:GG - 9] # get -20 to -9 if twelve == str(seq[f_abs - 20:f_abs - 8]): # -20 to -9 same break else: # -20 to -9 different for this GG ct += 1 else: # -8 to -1 different for this GG ce += 1 ct += 1 if ce == len(GGpos) and ct == len( GGpos): # -8 to -1 different for all GG output.append([ str(seq[f_abs - 20:f_abs + 3]), "8 different", row['strand'], row['Amplicon'], newstart, newend ]) # print("eight different: " + str(seq[f_abs - 20:f_abs + 3])) elif ct == len(GGpos): # -20 to -9 different for all GG output.append([ str(seq[f_abs - 20:f_abs + 3]), "12 different", row['strand'], row['Amplicon'], newstart, newend ]) # use with causion # print("twelve caution: " + str(seq[f_abs - 20:f_abs + 3])) else: # print("All same found! Do not use!") # do not use pass else: # GG not found on WT output.append([ str(seq[f_abs - 20:f_abs + 3]), "GG different", row['strand'], row['Amplicon'], newstart, newend ]) # print("GG not found in WT: " + str(seq[f_abs - 20:f_abs + 3])) else: print("No NGG found at line {}.".format(idx)) summary = pd.DataFrame(output, columns=[ '5_to_3_sequence', 'pattern', 'strand', 'amplicon', 'syn_FWD_start', 'syn_FWD_end' ]) if save: frames.to_csv("{}/{}_intermediate.csv".format(output_dir, output_name), index=False) summary.to_csv("{}/{}_search.csv".format(output_dir, output_name), index=False) print("Done! Results are in {}".format(output_dir)) return summary, frames
nrows = sheet.nrows #print (nrows) #print (xlsfile) #print sheet.cell_value(rowx=0, colx=2) oligo_row = 0 oligo_col = 2 name_col = 1 for oligo in range(sheet.nrows): cell = sheet.cell_value(rowx=oligo_row, colx=oligo_col) if oligo_row < nrows: oligo_caps = cell.upper() oligo_find = ref_seq.find(oligo_caps) oligo_rev_find = ref_rev_comp.find(oligo_caps) if oligo_find == -1 and oligo_rev_find == -1 or cell == '': oligo_row += 1 elif oligo_find != -1 or oligo_rev_find != -1: #print ('elif1') name = sheet.cell_value(rowx=oligo_row, colx=name_col) name_match_list.extend((name,)) no_match += 1 oligo_row += 1 #print (name) #print (oligo_caps) #print ("GOT IT")
'UGU': 'C', 'CGU': 'R', 'AGU': 'S', 'GGU': 'G', 'UGC': 'C', 'CGC': 'R', 'AGC': 'S', 'GGC': 'G', 'UGA': 'Stop', 'CGA': 'R', 'AGA': 'R', 'GGA': 'G', 'UGG': 'W', 'CGG': 'R', 'AGG': 'R', 'GGG': 'G' } str1 = "AUGUCCGGCCUCAUCAAUACCUAUUGUCGGGAUGCCUUCUCUACCCCACCGCCCUUAACGGCUACGUGCACAAGAGGGGGAUAUAUUCCAGCGGCCAAUCUCCUCUCUCCUAGCUUCAGGACUUCAUUUGGGGGAGAAUCGCUGAAUGGCCUUCUGGUCGGAGGGAGAAUAGUUCCGAAUGCUUCCGUCCGUCGGUCGCAGCAAGGUAGAGACGGCCUUUGCGUUGGCGUGUCUCUGUCUUGUUGGACGUACGCCGAAUUUCUGAUACGACACGACCAGAUCCGGUCUCUCUGCGAAAGGCUGAACUCCUUUGUACCAGACUCCAUAAGAGUCAGGUCAAUGAGCGACGCCGCAGCUGAAUAUACCAUACUAAGUGAGCAAGUUCCAGACACGAAGAUUGCGUCCCGGUGCGACUGGGUAGCAAACACAAAUUUUCACAAUCGUUGUACGCCUCACGAGUCCAUGCACUGGACGUGUCCCCCUAGUUUCUAUUCGCCUACCGUAACUCUUUCACCGAUCAGUAUCAGGUAUGGCCAGAAAUCCAGGCUAGCGAUGAUACUGUAUGUGAUAAAAUUACGAAGCGUACGCGUCCUUGUAUCAAUGCAAGCAAGCCCGGCAUCAGGACCUCGACGCCUUUUCACUAGCCCCGGCCCGCGAUCGUCCGGAUAUCGACAUAGCUCUCUCCGCCACCGGGAGUUGUACAUCGUGUUGUCAUGCACUAGGUGCUCUGACCUACGACUUGAGAUCAAGCGCUCGCCUUUAUUUCGCUCUUCCCCUGACGUUCGCCGUAGCCGCCAGAUCUCCUGGUCUAGGGGGAUUGGAACGGAGGCUGGUGCCUUUUCAGGGCGAUUGCGUGCGGUGAACCGCCAAGUCGACUUACUGAAGGAGUCAGUUAGUGUCAGGUUGUAUAAGGUGGGAGCUUGGGGUGGUUUGCGCAUUACGUUUCACAUCAUAUCGCCGGAUUAUACCGAGUGGCGUGGGUGGGAUGUUCCCAUUCUAAGUUCAUUGACUCAUCGACGCGGCAGCGACCUGACGAGGCGCAUAAAAAUUCGGGCUAGGUUGCAAACUUAUGGUCAUGCUGGCUGGCGCUGUCUACACGUAAGCUACCCGGCCCUGGUCCGUCGCAGAGCAGGACGGGCUAGUGACUUACGUCGCUUCCGUCAGAAGUUCCAUCUUAAAAAGCGGAUACUGCACGUUCAGACGGUAGGGCUAUGCAGGCCACCGAUUCGAACUCGUGUUAGAUGCGACCGACUUAUAGAAAGGUUCUUAACAAGAAGGCCUAUCGGCCCCCUGAUAAAAUCCCUCUCUAUUCAGUCCCUUUGGACAGGACGCCGCGGUACGGCUACGCAAGCAUCCCCAAAACUUGAUGCCAAAUCCAUGUAUUCAUUGAUAGGUAGGCGAGCGACCCGGGAGUCCGCGCUUAUAUACUUUCCUACCGCAUCCUGGAAUAAGGUCACUCUCAUUAUAGUGGCGGGGCGUCCUGUAGUUGUUUCCGGUCGCCCUCUCUCUACCAUAACCCUCGACGAGGGAGCGAUUCUAGCCAAGGGCGCAACUCCCCGAGAGACUCAGGUUCUUAACUACUCUGUUCAUGCGUAUUUUCAGACCCCCUCGCCGGAGGGUGGGUACAAAACACUGCCGGACCUCCAGAACGCGAGCCUCAAAGGACCUUUCAAGGCAGUCAGUCACGCGCUUCUCGCACCCGCAGUGCGGUGCGUCCUGCUUGUUUAUCGACUCUUUGCGACCAGCGGUAUACACGUGUACAAAUACCAUUAUAUUGUAUAUUGCGUCAAUAGAGUAGAGUGUACUGCCGAUAAACAUCCUCUAAUUGGAGGGCCCAGGAGUUGCUGGACUAACGCGCAACAAUUGGGCGAACGCGUAGGAAGUCGGCAAAGCAUACUAUACAGUGAUGGUCACCAACUUUGCGUUCAUGGGGAGCACUUACGUAGCCCCCUUUGUCCGAAACGCGCGCUAGCGAGGGACGCACGUUAUGCGAGUACAACGUCGAUUCAACCCCGGGGCAACGAAUGGUGGGGCAUCGAUUCCGAGACUCGGCAGCGGACCUAUCGGACUCAAGCCCCUUUAAAAACUUGGAUGCCGGACACAGAAUUGCUAUCGAAGGGGCCAACCUGUUGCUCCCACCGAGACCCUGCGCGGCAUUAUACCGUCCCUAGUUGCCAGGAACGUUGGGUAGAGCAACUCCUCCAACGUUCUGGCCACCCCCUUCAACAUUGCAUUGUGGCGGUAGGGGAUGACUGGUCUAGCAAAUGCAUGUUCCAUAUGAUCCACUUGUCGCUCCGGGGGAUCGAGAAGAGCACAGCUAAUAUACGAAAUAACAACAUGCGCGUCGCGCAUGGAAGAAGAACCUCGCCCCUCGGGACUUGCUUACUUCCGAUCUCAUCUGUCCCCUUCCGACUAUGCUGUUGGUCGCUAAUGUCAGACUACCCGCCAGCUGGCCACACCAAUCACAAUCGUGAAGCUCAUAAAGACAAGGUAAAAACGCGAAGAAUCUGUCUGCCUUGCCCCGCACCGAUUGGGCCCCAGGCCGUUGCUAGCCUGGUUAUCAGGGGUCUCACACAUGGAGGCUCCCUAAUGGCGCCCAACACAAUAACGGUAGCGAUGAUGCACGUCCAUACGCAUGUCUAUCCUGACAUAUACAUCUCUCAACACCUAUCUGAGGCGACGGUUUCUGCGUCUCGCCAGAUAUGGACUGGUGUGCAGACUUUUGCGCGGCUUAGACGGACCUCUAACAGCAUGAUUUCUAUUGAUGCUGACUUCACACUGGGAGUUUCCCCUACCGGAACUACGUUCGACGCUGCCCCUUCUAAUGUACCUUCCCUCAGGUUUGGAGGGAGGUGCUGUCAACAUUACCGGCACAACGCGGACGGUAGUUUUCCUGCGAGAAAAAAGCCGAGUAGGCUACAUAGAACCCCAGCUGAAAGCACAUUAGUUUUAAUUAGCGGGACAGGAUCUCAAAAAGCAAUUCGACGUCUCAUAAACAUUAGGCGUCGACCUGCCAGGAGUGAACAUGGUCGUAUUAUGAAAGCCCGAAACCCUCAUCAAUGGAUAUUAUUUCGAAUAUUCGUGAGUUGGCAGUUUUGCCAUACCACACCAGCCAACUGCUGUUUAAUCGGGGGUCAAUUCCUCGGAGACGUUUCGGGUCAUACGGUCGGCGGCAAUGAAAGCGAUAAAACUAAGCACACGCCAGCUAUCUCUUCAGGGAACCCUAUUAUAGCCUCCCUAGCUGCUUCCGUAUUUCUUGUUGAUUGCUGUUGGUCACAAUACCCCUUCCUUAUAACCUGCCUUAAAGGUGAAUCCAGUGAGAGGGGAGAUUCUACUUCCGCCAAACCAGAGAACUAUUCCAGUGCCGCCAAAAUCAGCGUGAAGUUCUUUACGACCUCAAAUGUUAGAUGUUAUCACGACGUUCUCCCAUUCUUGAUUCCUCGGAUUCAUCUAAGUCAUAUGAAAGCCCGACUACACCUGUUAUUAUGUGGAACCGGUAUAAGGUCCCGACUAGACAAGUUUUUUACAACCCGUGCUAACGAGCUCACAUUAAGGAUUCCGUACGAAAUGAGAGCUUGCCAAGUAAGGCGGCGCAGUUUAGACGCAAGAUACAAGGAUCGACAUGCAGUCGUCAUGAAAUUCAGGUUUAUCGCUCCGCGCUGCUACCCAAUCACCGUGAUUCAGUGUCCUCGCGCGAUGGUUCCACGGACUCCUAAUCGGUCGAGGACUCAUGACUGUGCACUCUAUACUCGUAAAAGUAGCUCUAUGGAAAAAGUACGCGCUGCGGCCGUUGGAGUAGCUUCAGGUUCUGCAAAUCAGGGCCUCCUUAGAUUGCGCUGCCGUUUUGUUAUAAUGAGCCUAGACGUUCCCCCCCCCGCGUCAAAGGACAGCCCGUGGUUAUUUGACACAGGCGGCCAACGGAGCAGUCAUGUGAAGACGUCUCAAGUGCGACGCGGAUUACCAACUAAAAAAUGGGCUCAGAGCGUGAUCCUGGGAAUGAACCGUAAUGGAGGCCGUACUUGUGGAGAAACAAGCUUGAAGCACUUCUACCACCUUUUCCUGGAGAUUUAUCCCGGUAAUCGAUGGCGGCGGGCUAGUUGUCAAUGGAGAAUUAAAUUGGGUCAGUCUAAUCUUUGCCCAACAUUGAGUGUUAAUGGCCCCCCAUUUAGGUCUACGUUCCGGCAACCGAAACUUCCGCACCAGUGUCCACCUGGGGGAUUACUACUCACCGUGAGCCGUGCGCCUUGGCUGGAAUCAUCGCCUCAAACACGGGGUAACCUUGACCCCCUGUCGAGCAUCCUUUCCGUGCUGUUGACACUUGACAGGCUAGCUCUUGGAGGGGAAAACCAGAGGAGACCCCGAUUGGUCAACGAAACAGCCGUGGGUGUGCAGUGUAUCAGGACACGUGCUCUACCAACGCCGGAUACCCCCCUCUGGGGCACUCUUGCUGGAAGAGCCUUAGUCGGCACCCAGGCGGCACCACAGAAACUUAGCAGCCGGCGAAUUGGGUUCCGUGCCAAUAGCAAAGCGGUGUCUGGGCCCCAUCGAGACUCAAUUCCAGGCCGUAAUCACCAGGGUCACCUAGAGCGUUAUUUUAAGUGCUCUGCAAAUUUGCGGCCGUCGCAGCGCAGUCCACGCAGGGUGCCACGACCCACAAGCGGCCAGUGUGUCUUUUCUCCUAACCAGUUGUGGUGUCUGUAUUUGCUUUGGCUUGCGCCGUGCCAUGCCACACACGCUUUUGGUAGGUUCGCCGUAAGGCGAGCCUGCAUGUUAUUUAUUGUCAAUCCGGAGCGUCUCCGCAUCGGAUGGAAAUCCACCAAGACAUCCCAAUAUCAGCUCGAAACAGUACCCGCUACUUAUACAUGUAGCAGAUCCACAGUAGCUGCGGUGGUCAUACACGGCAAAGCAUAUGUCGUCGGCGUCAAAGAGUUCACUGGUAUGCACUUUGCGCGUGAUUUAGACCGGCGCAGGAGUAACUCCGGGUACGUCGGAGCAUUAGAACCUGUGAGGGCCGGUGGGCUGAAGGCCAUCGAAGCCAUAGUCCAUUUGUGUUCGAAGACAGUGCUGUCAAGGUCGUGGUCUGGUACUCACCCGUUUCCAAUCGCAAGAAAGAAGAAGAAACGUUGUACUGACCCUGAGGUAAGAGUCAGGUGUCGGACCGGGGGCGGGAACUACAUAAGUAGGCACCUGAGUCUAUGCGCGACUUGUCGCCAAAAAUGGCGCAAGAUAUACGAAUUUCUAUACAAGUUGUACUCACCAAGUGAUACAUCGAGUCAAACAGAAAUGGCUCUCGUUGGACAGGAAUGUUCAAUCAGCGGGAUUCGUGCCAGUAAGCAUCGUCAUAGGGAAACCGAGGAAUCACCAUGGGAUUCGGGCCCGAGUUGGAGCGAAUCGACAAACGCAAUCGGCCUUGGCCUUUUGGCUAGUCAACACGCUCCACACCUAGUUGGCAUCUGGUUUCACUGUCCACUCCCAAAACUUACCAGAAACGACACGAGCCUUAGCACGACCGGUUAUUCGACAAGUGGUCAAAAUGAGCGCUCUGCAUACUGCAGUUUACGCGCCCCGGACCCCGGGAACGGACCUGGACAUAUCCACCAGGGCACGGCCUCUAGACAAAUCGGGACCGACAGUACGUCAAAACUCGGUGAGCCACAUGCCAGGGGGUCUAUGAUGCGACAUUUGAUCCACGUAGAACUUGUCGCGUAUACGACCGCCCUAUUCCUAUUGCUAGCAACAACAGGGGGUGCACUACUGUGCAUGACGCGACACUUCACCUUGGACGUCCGAUCGAAGCUUGGUUCGUUCGUUCUAGGAGCCGGCCAGGAGGGCUGCCCUCGUGUAGGUUAUCUAUCGCAUUUGGGCCUAUGUCUUAGACGGAUCACAAAAGCAUGUGCAAUCAGACGCGCUGAUAUACCCCACUGCGCGACUGUGCCAUUGACGACUCACCUUGUUGCCCUAGACGCAAUCCAACAUGGAGACCGUUCCUAUGCGUUCUGUCUUAUUGUUGGACUCAGUGGACUUAUGGAUUGUUACGUGGAAAUCAACGUUAUAUAUCCUAUAAUUUACAUUCGACGCCCCAGACAGCAUACUGGGCGUGCAAUGGGGGAGUGGAUCCGCUCGAUACAUGCAGCUGAGGACUAUCAGAGAGAACAGCAUCAUUUUGCAAGUAUUCGCUGGCACUCACAUGCUACCGGCAGAUCCUUCCUUGCAGUCCGUCGUUUUGUUGGAGUUAAAGUUGCGUGGCCCUUAGUUGCUCUUGAGUCCCUGACGCUAGAAAGAGAUCGCUCCGUACAAAUGCCUCUCUGGUCCCUGCUAGAGCAAGCGUACACGAGGGUUGUAUUUUUCACCCCAAGAAAUGGGUUAUGUGUUCUAGACCAACAUUGCAGGUGGGCUGCGGCGACGCCAUCCAAGUCAUCGCGUAUGGAUCUUUUCUACGGCGAGCCAGUUUCUUGUGAAUGGGUCGCCGUCAGGCCUUCCAGAUAUGCUCAAGUAAGAAUAGGGAACGAUCACAGGGUCUCAUAUGGUACGAUUAGCGACUGGACCUCGCAUGAGUUAGUCAAUUACCUCCAAAACAAUCGGGAGGCGUACCUACCUUCCAUUCUACCCUCCAGCCUGGUAGCAGAUCCCACGGGUAGCGACCGGGAAACAUCUAUUAAACUUUGCACAAGCCGCGCAUACUCCGCGCACUUGAAGGAUUCGUGUCCCUCUGUUUGCCCUCUUAUACCAGAGCGUUCGCCGCGACCCGACAUUAAGUUUCAGCCGAAGAUGCCACGUGUACACGACAUGGCAUUCUGCGAUGUACUUCCGGUCGUCUGCCUAAUAUUGACCUCGACCCUGCCCGCCAAUAGGACCUCCGUGAAGAGUGCUCAAAAGGCGGGCCCCGCUUCUAAGGAGGAACCUACUCAGGACCCGAUGCGAGUCGUGGCUUCCGGGGAUGCGCUCGUAAGUACUAUUUCGUGCCCUAUUAUCGAUAUUUGGAGCAAAUACAAACAUCCUAAGGAAAGCGCUCGAAAAAACGUUAAACAGCAUCCAAGCCGCUGGUCGCGCGGAAAUGAAUGUCAACAGUCCGCGGGGUAUUAUGAUGAUAGGGACGGCCGCUGUGUUAAUUAUACCGGUCAUCUCCGAUACUUCCCGCUGCCGGGAGUGACUCGAUUUGUUAACGGCGAUUAUAUACUGCAAACCAACAUCACUAAGAGAACUGUGUCUUUGAUAAUUGGGCGCGCCAGAACCGCGCUAGCUAUAUUUACCCCGAGAAUUACUUGCGAUGGAAGUCGUAAUUUAAAGCCAAUAAUUGAAAAAAGCGGCCCAGGAAAGAGUCCUUUCGCACCAGGUUGGACCCGCAUGUCGUUGCCUCAACCACAGUGCAGGUUGUGCCCAACCGAAGCCCCGUGUUGUGCAGCCGAAUGGCCGUCAAUGCCACCCCUCGUCGUGUGGCCCCACUCCUUAGCUUUUUGGCCUCACGAAAGCUUGGAUGUCGUAUACAUUUUUAUCAUGACUUCAACCCCAGGCGUCUCCCGCAAUCUAUCGGGAUAUUUUAGUUGCCCAGUAGUUGCACGAGGACACGGUACGCACGCUAUGGCUCGUACCGUAAAACGACGUUUACAUAAGUUUCUGUCGUUUAGCGGUCACACAAAACGAUUUGAUGAACUAACUGCCACGGUCUGGCUUAUCAAGAUUAUAGCCCGAGUCUCCGUCACAGGUUCACUGGAGCGGGCUAGUCGCUCGAAUUUCGUAAGGGAGUGCUUCAGAUGUGUAGGCCGUCGCUCCGGGCGAUGGAUGACGUCUCGGUGGUCAAAUAUGACGCGAGAAUGGCCGCAUACAGGCCGAAGAUUUUGGAUUCCCUAUGAGCGUAUAGGUUGUCAAGUCAAGUGGAGGGUCACACAUUUUAGGUGGGUAACGGAAUGGGACUCAAAAACUGCCAUUCACGCGUCCUUACCGCCGUUAACCGACCUUCGAGGAUACGGCGUAUCGUACCCGCAACCAACUUGCUUGACACUCAGUUGGCUUAGGCGCUGCCUACGGCGGACGGUGGUGAAAAGUGGUGAUGCUUACCCCUAUGCAUGCAUUGAUCUCGCGUACGUUAAUAAUGUAUGUAAUGCCUGGCGGCGGGUGAUUUGCUCACUGUGGACGCUAGCUAACGGUCCUAUGUCCGGUUAUAACUAUCAGAGGGCACUGGGCAGAGGGUCAAAUAGGAUUGUCAUGACCAAUUCUUCCACGUGCUGGCGAAGCCCGAUGUUUAUAAUACAUGUCUCAGAAGGCGAAGUUCGAUUAUCCGUGAGGCAAGGACAUCGCACAAUUCUGCUAUGCAACCCUGGGGCCUAUUCCCAAAGUCAUCGCUCUUUUUACGCUGAUGACCAAAACGGAAUUAACACGUGCUGUACGAUCGCGGAUUCGAAAACACAAGCUGAAGGUCUUGUGUUAGUGCGCUUCGAUUGCAAGCAAAUUGUCAAACUCACACGGCAGCGUCAGACUAGGAACACUUGGGACUACACUACAAUGGGAAGCGCCGAGAAAAGGUUCCAUGCGCGCCCCCGCACCAACAUAUCUCUACUGAAUGUAUACGACGCGACACCAUACAAUGGGCAUGGAGUGCAUGGGCCCAGUACGUUCCAAACGAACCUUGGACCGAACCGACGCUACCCGGUUCCCUGUCGAUUGCCCCCUCUAACUGCGAUAUUAACCAUAGGUCCGGGGCGGGUUGGAGAAUCCGCGCUCGGAAUAUUACGGAUCGUGGAUGAUGUGAUGUUGAAUAUAACGGGCCAUAAAGUAUUGACUACCCAUAUCAAGACAGGUGGGUAUGUCUCUGGUCGCGGGUUUCUGAUUGGUCGUCUUCAGGCGGACGGGUAUACGUUAAUUGCUAUUUUUCGGCCUACAUGGUACGACUGCUUCCCUCGAGUCUGUUUUCUGAUUCCAGUUAGGGCUUCCCCUCCAAUUAAGGGACUAGUCUGCUCUCCGGACACAGCCACCGAAUUCGCAACAAUGUCGGGUCUAUCAAAGCAGGACGCAGGAAACUCCGUGUCCACGUUAUCGACCCCACUCUCGCCGCCGGUGCUACGCAGGCACGGCCUCAACAAGCGGUGUCCAGAGACUGGAGUCUCAUUCAGCACCGGCCUACUAAGUCAAGUAAAUGAUAGCCAAGCUAGCGUAUCAAUAUACGUAGCUAAUCCAAAUACAAAGUGGUUCAGUCGAGGUGAGAACGUAAGUGGGUCACUCAUUGCAUGUGUCCGAUACAUUCGGACCGCCGCGAUGGGCUUAUGGUCAUGGUCAAUGUUUUUGGCGAUCGUAUUCAUCACUGACAGGAUCUUAACUUUACAGUUGAUGGGGGUAAAGUACGCCUCUGCUGUUAUGACGGCACCGAGAGGGCGCCAAAUGCCCCACAACCUUUCCUGUACUCAGAAUUGGACGCUUGUGCGUAAAGUUACUCCGGCUGUUACUGGCUCUCGAAUACCUCAGAGGACAGCAGGCUGUCUCAGGAAUCUAUACUGGUGUUCGUCCGAUAGCCCGACACUUUUCCGUGGAGGCCAGAUAAUGCCAAACUUUUACCGUAGGUCCUCACUCGUGCCUCGUCCAAUAGCGCGGAGUCACCGGCGGAUUGUACUGUCGGAACAAAUGAUCAACAUCGAUUGGGAGAGCAUCUGUUCACUACGGCACACGACAUGCUCGCAAAGGGCUUUAUGUCAUGAGUGGGCGAGGGGCUACGCUCAAGCGGCUACGUUAGCUAUCUUAAUUCACAGUGCGAUCCAAGACUUGUUCUAUCAGCUACUCAGCGCAGUGAUAUUUUUUUUUCCCAUUACGAUCGGACCUCGUAGAUUUGUCAAAUACGUUCCAAGAUCACCGCUAUGUCACUUGCGAUUAGUACUACGGCAUUGCUUUGAGCGUGAAGCUUUUGGCGGUCAUCCGAAUAGACCUGUUGUCAACACUCAUGCUCGUCAAUGUAUGGGUACGAAGACAGAGUGA" #Use translate method to translate RNA to protein using the hardcoded sequence str1 = Seq(str1) protein = str1.translate(to_stop=True) print(protein) new = "" for i in range(0, len(str1), 3): symbol = RNA_Dict[i:i+3] if symbol == "Stop": break new += symbol out = [] protein = "" start = str1.find('AUG') tr = str1[start:] for n in range(0, len(tr), 3): if tr[n:n+3] in RNA_Dict: if RNA_Dict[tr[n:n+3]] =="Stop": out.append(protein) protein = "" else: protein += RNA_Dict[tr[n:n+3]]
def a(self): import sys from Bio.Seq import Seq from Bio import SeqIO import re inputlist1 = self.x inputlist2 = self.y outputfile = open("pep_pos_in_mRNA.txt", "w") outputlist = [] dic = {} for num, x in enumerate(inputlist1): # rna sequence containing file x_ls = x.split("@") header1 = x_ls[0] header1_ls = header1.split(" ") mrnaacc1 = header1_ls[0] dic[mrnaacc1] = x for num_y, y in enumerate(inputlist2): # RNA acce|Pepseq|PSM if num_y % 100 == 0: print num_y y_st = y.strip() y_ls = y_st.split("|") mrnaacc10 = y_ls[0].strip() pepseq10 = y_ls[1].strip() psm10 = y_ls[2].strip() v = dic.get(mrnaacc10) if v != None: v_ls = v.split("@") mrnaseq = v_ls[1].strip() chrom1 = re.findall("loc:(.*?)\|", v_ls[0]) chrom3 = chrom1[0] if len(mrnaseq) % 3 == 0: mrnaseq1 = mrnaseq.upper() elif len(mrnaseq) % 3 == 1: mrnaseq1 = mrnaseq.upper() + "NN" elif len(mrnaseq) % 3 == 2: mrnaseq1 = mrnaseq.upper() + "N" f1 = Seq(mrnaseq1).translate() f2 = Seq(mrnaseq1[1:-2]).translate() f3 = Seq(mrnaseq1[2:-1]).translate() if pepseq10 in f1: pepstpos = (f1.find(pepseq10) + 1) * 3 - 2 # 1st nucleotide of codon elif pepseq10 in f2: pepstpos = (f2.find(pepseq10) + 1) * 3 - 2 + 1 elif pepseq10 in f3: pepstpos = (f3.find(pepseq10) + 1) * 3 - 2 + 2 if pepstpos >= 0: pepsppos = pepstpos + (len(pepseq10) - 1) * 3 while pepstpos <= pepsppos: result = chrom3 + "\t" + mrnaacc10 + "\t" + pepseq10 + "\t" + str(pepstpos) + "\t" + str(psm10) outputlist.append(result) outputfile.write(result + "\n") pepstpos += 1 return outputlist
class seq_utilitiesTest(unittest.TestCase): def setUp(self): self.s1 = 'GACTAGACTTAGT' self.s2 = 'GACTATAACTTAATATAG' self.s3 = 'GACTATAACTTAATATAC' self.s4 = 'GACTATAACTTAATAWAC' self.seq1 = Seq(self.s1) self.seq2 = Seq(self.s2) self.seq3 = Seq(self.s3) self.seq4 = Seq(self.s4) self.sr1 = SeqRecord(self.seq1) self.sr2 = SeqRecord(self.seq2) self.sr3 = SeqRecord(self.seq3) self.sr4 = SeqRecord(self.seq4) self.fastq2 = SeqRecord(self.seq2, letter_annotations={ "phred_quality": [ 1, 2, 4, 10, 20, 25, 33, 22, 33, 35, 18, 11, 23, 8, 2, 1, 2, 0 ] }) def test_find(self): self.assertEqual(find_first_stop(self.s1), 3, "Misplaced stop codon") self.assertEqual(find_first_stop(self.seq1), 3, "Misplaced stop codon in seq1: " + str(self.seq1)) self.assertEqual(find_first_stop(self.sr1), 3, "Misplaced stop codon") self.assertTrue(internal_stop(self.s1)) self.assertEqual(find_first_stop(self.s2), 15, "Misplaced stop codon") self.assertEqual(find_first_stop(self.seq2), 15, "Misplaced stop codon in seq2: " + str(self.seq2)) self.assertEqual(find_first_stop(self.sr2), 15, "Misplaced stop codon") self.assertFalse(internal_stop(self.seq2)) self.assertEqual(find_first_stop(self.s3), None, "Misplaced stop codon") self.assertEqual(find_first_stop(self.seq3), None, "Misplaced stop codon in seq3: " + str(self.seq3)) self.assertEqual(find_first_stop(self.sr3), None, "Misplaced stop codon") self.assertFalse(internal_stop(self.sr3)) def test_trimORF(self): t1 = 'GAC' self.assertEqual(trim_at_first_stop(self.s1), t1, "Misplaced stop codon") self.assertEqual(trim_at_first_stop(str(self.seq1)), t1, "Misplaced stop codon in seq1: " + str(self.seq1)) self.assertEqual(trim_at_first_stop(str(self.sr1.seq)), t1, "Misplaced stop codon") t2 = 'GACTATAACTTAATA' self.assertEqual(trim_at_first_stop(self.s2), t2, "Misplaced stop codon") self.assertEqual(trim_at_first_stop(str(self.seq2)), t2, "Misplaced stop codon in seq1: ") self.assertEqual(trim_at_first_stop(str(self.sr2.seq)), t2, "Misplaced stop codon") t3 = 'GACTATAACTTAATATAC' self.assertEqual(trim_at_first_stop(self.s3), t3, "Misplaced stop codon") self.assertEqual(trim_at_first_stop(str(self.seq3)), t3, "Misplaced stop codon in seq1: ") self.assertEqual(trim_at_first_stop(str(self.sr3.seq)), t3, "Misplaced stop codon") def test_trimFASTQ(self): trimmed = trimFASTQtoFirstBase(self.fastq2, 10) self.assertEqual(self.seq2.find(trimmed.seq), 3, "Left trim is wrong 1") self.assertEqual( self.seq2.reverse_complement().find( trimmed.seq.reverse_complement()), 5, "Right trim in wrong") trimmed = trimFASTQtoFirstBase(self.fastq2, 40) self.assertEquals(trimmed, None, "Sequence should be discarded") trimmed = trimFASTQtoFirstBase(self.fastq2, 22) self.assertEqual(self.seq2.find(trimmed.seq), 5, "Left trim is wrong 2") self.assertEqual( self.seq2.reverse_complement().find( trimmed.seq.reverse_complement()), 5, "Right trim in wrong") trimmed = trimFASTQtoFirstBase(self.fastq2, 23) self.assertEqual(self.seq2.find(trimmed.seq), 5, "Left trim is wrong 3") self.assertEqual( self.seq2.reverse_complement().find( trimmed.seq.reverse_complement()), 5, "Right trim in wrong") trimmed = trimFASTQtoFirstBase(self.fastq2, 35) self.assertEqual(len(trimmed), 1, "trimmed too long") self.assertEqual(trimmed[0], self.fastq2[10], "Wrong base recovered") def test_Ambig(self): self.assertTrue(unambiguous_sequence(self.s1)) self.assertTrue(unambiguous_sequence(self.seq1)) self.assertTrue(unambiguous_sequence(self.sr1)) self.assertTrue(unambiguous_sequence(self.s2)) self.assertTrue(unambiguous_sequence(self.seq2)) self.assertTrue(unambiguous_sequence(self.sr2)) self.assertTrue(unambiguous_sequence(self.s3)) self.assertTrue(unambiguous_sequence(self.seq3)) self.assertTrue(unambiguous_sequence(self.sr3)) self.assertFalse(unambiguous_sequence(self.s4)) self.assertFalse(unambiguous_sequence(self.seq4)) self.assertFalse(unambiguous_sequence(self.sr4))
def generate_se_sequence_combination(df_SE, dfname, dbname, rna_db, het, exclude, output_name): version = get_version(rna_db) if (version == 'swissprot'): db = 'sp' else: db = version trans_seq_dict, trans_coding_dict = generate_all_se_db.get_trans_seq_dict( rna_db) print("transcript sequence dict ready") print(len(list(trans_seq_dict.items()))) df = pd.read_csv(dfname, sep='\t', header=None) change_df = generate_all_mutation_db.extract_transcript_change(df) trans_index_dict = {} for i in range(0, change_df.shape[0]): if (change_df.iloc[i]['mrna'] not in trans_index_dict.keys()): trans_index_dict[change_df.iloc[i]['mrna']] = [i] else: trans_index_dict[change_df.iloc[i]['mrna']].append(i) trans_records, strand_dict, protein_id_dict = generate_all_se_db.get_trans_records( dbname, trans_seq_dict) splicing_event_dict = generate_all_se_db.get_splicing_event_dict( df_SE, trans_records) print("splicing events dict ready") trans_exon_dict = generate_all_se_db.get_transcript_exon_dict( trans_records) print("transcript exon dict ready") middle = time.time() print("---- %s minutes ----" % ((middle - begin) / 60)) trans_db_annotation_dict = {} ##output cnt = 0 trans_records = trans_records.sort_values(by=['exon_id'], axis=0) for k in splicing_event_dict.keys(): cnt += 1 if (cnt % 1000 == 0): print(cnt) down_id = splicing_event_dict[k][0] skip_id = splicing_event_dict[k][1] up_id = splicing_event_dict[k][2] for key in trans_exon_dict.keys(): T = trans_exon_dict[key] if ((down_id in T) and (up_id in T)): #print(key) down_index = T.index(down_id) #print(down_index) up_index = T.index(up_id) low_index = min(down_index, up_index) high_index = max(down_index, up_index) tmp_exon_coordinate_dict = {} tmp_exon_position_dict = {} tmp_pos = 0 for item in range(1, len(T)): ei = generate_all_se_db.find_key_index( 'exon_id', T[item], trans_records) if (ei == -1): print("the exon id cannot be found") else: tmp_start = trans_records.iloc[ei]['start'] tmp_end = trans_records.iloc[ei]['end'] tmp_exon_coordinate_dict[T[item]] = ( trans_records.iloc[ei]['chr'], tmp_start, tmp_end) tmp_exon_position_dict[item] = (tmp_pos, tmp_pos + tmp_end - tmp_start + 1) tmp_pos += tmp_end - tmp_start + 1 tmp_seq = trans_seq_dict[key] coding_start = trans_coding_dict[key][0] coding_end = trans_coding_dict[key][1] het_list = [] hom_position_list = [] if ((key in trans_index_dict.keys()) and (key in strand_dict.keys())): shift = 0 transcript = tmp_seq hom_des = [] for i in trans_index_dict[key]: if (change_df.iloc[i]['mutation_type'].find('snv') != -1): if (change_df.iloc[i]['snp_type'] == 'hom'): hom_position_list.append( (int(change_df.iloc[i]['c_start']), change_df.iloc[i]['mutation_type'])) if (strand_dict[key] == '-'): tmp = Seq( str(tmp_seq), IUPAC.ambiguous_dna).complement() tmp = str(tmp) transcript=generate_all_mutation_db.change_seq(tmp,int(change_df.iloc[i]['c_start'])+shift+coding_start-1,\ int(change_df.iloc[i]['c_end'])+shift+coding_start-1,str(Seq(str(change_df.iloc[i]['c_content'])).complement()),\ change_df.iloc[i]['mutation_type']) else: transcript=generate_all_mutation_db.change_seq(tmp_seq,int(change_df.iloc[i]['c_start'])+shift+coding_start-1,\ int(change_df.iloc[i]['c_end'])+shift+coding_start-1,change_df.iloc[i]['c_content'],\ change_df.iloc[i]['mutation_type']) hom_des.append(change_df.iloc[i]['mutation_type']+":"+str(change_df.iloc[i]['c_start'])+'-'+\ str(change_df.iloc[i]['c_end'])+str(change_df.iloc[i]['c_content'])+'_') # if(change_df.iloc[i]['mutation_type'].find('del')!=-1): # shift-=(int(change_df.iloc[i]['c_end'])-int(change_df.iloc[i]['c_start'])+1) # elif(change_df.iloc[i]['mutation_type'].find('ins')!=-1): # shift+=(int(change_df.iloc[i]['c_end'])-int(change_df.iloc[i]['c_start'])+1) else: het_list.append(i) het_number = len(het_list) het_des = [] het_seqs = [] if (len(hom_position_list) != 0): if (strand_dict[key] == '-'): tmp = Seq(str(transcript), IUPAC.ambiguous_dna).complement() tmp = str(tmp) else: tmp = transcript het_seqs.append(tmp) else: if (strand_dict[key] == '-'): transcript = Seq(str(transcript), IUPAC.ambiguous_dna).complement() transcript = str(transcript) het_seqs.append(transcript) het_des.append("") if (het == 1): for n in range(0, het_number): tmp_het_des = [] new_sequence = "" splicing_position = 0 if ((high_index - low_index) == 1): splicing_position = tmp_exon_position_dict[ low_index][1] elif (T[low_index + 1] == skip_id): splicing_position = tmp_exon_position_dict[ low_index + 1][0] if (abs( int(change_df.iloc[het_list[n]]['c_start']) - splicing_position) <= 900): if ((int(change_df.iloc[het_list[n]] ['c_start']) >= coding_start - 1) & (int(change_df.iloc[het_list[n]] ['c_start']) <= coding_end)): if (strand_dict[key] == '-'): new_sequence=generate_all_mutation_db.change_seq(transcript,int(change_df.iloc[het_list[n]]['c_start'])+shift+coding_start-1,\ int(change_df.iloc[het_list[n]]['c_end'])+shift+coding_start-1,\ str(Seq(str(change_df.iloc[het_list[n]]['c_content'])).complement()),\ change_df.iloc[het_list[n]]['mutation_type']) else: new_sequence=generate_all_mutation_db.change_seq(transcript,int(change_df.iloc[het_list[n]]['c_start'])+shift+coding_start-1,\ int(change_df.iloc[het_list[n]]['c_end'])+shift+coding_start-1,change_df.iloc[het_list[n]]['c_content'],\ change_df.iloc[het_list[n]]['mutation_type']) tmp_het_des.append(change_df.iloc[het_list[n]]['mutation_type']+":"+\ str(change_df.iloc[het_list[n]]['c_start'])+'-'+str(change_df.iloc[het_list[n]]['c_end'])+\ str(change_df.iloc[het_list[n]]['c_content'])) # if(change_df.iloc[i]['mutation_type'].find('del')!=-1): # shift-=(int(change_df.iloc[i]['c_end'])-int(change_df.iloc[i]['c_start'])+1) # elif(change_df.iloc[i]['mutation_type'].find('ins')!=-1): # shift+=(int(change_df.iloc[i]['c_end'])-int(change_df.iloc[i]['c_start'])+1) het_des.append(tmp_het_des) if (strand_dict[key] == '-'): new_seq = Seq( str(new_sequence), IUPAC.ambiguous_dna).complement() new_seq = str(new_seq) else: new_seq = new_sequence het_seqs.append(new_seq) elif (het == 2): for n in range(0, het_number): tmp_het_des = [] new_sequence = "" splicing_position = 0 if ((high_index - low_index) == 1): splicing_position = tmp_exon_position_dict[ low_index][1] elif (T[low_index + 1] == skip_id): splicing_position = tmp_exon_position_dict[ low_index + 1][0] if (abs( int(change_df.iloc[het_list[n]]['c_start']) - splicing_position) <= 900): if ((int(change_df.iloc[het_list[n]] ['c_start']) >= coding_start - 1) & (int(change_df.iloc[het_list[n]] ['c_start']) <= coding_end)): if (strand_dict[key] == '-'): new_sequence=generate_all_mutation_db.change_seq(transcript,int(change_df.iloc[het_list[n]]['c_start'])+shift+coding_start-1,\ int(change_df.iloc[het_list[n]]['c_end'])+shift+coding_start-1,\ str(Seq(str(change_df.iloc[het_list[n]]['c_content'])).complement()),\ change_df.iloc[het_list[n]]['mutation_type']) else: new_sequence=generate_all_mutation_db.change_seq(transcript,int(change_df.iloc[het_list[n]]['c_start'])+shift+coding_start-1,\ int(change_df.iloc[het_list[n]]['c_end'])+shift+coding_start-1,change_df.iloc[het_list[n]]['c_content'],\ change_df.iloc[het_list[n]]['mutation_type']) tmp_het_des.append(change_df.iloc[het_list[n]]['mutation_type']+":"+\ str(change_df.iloc[het_list[n]]['c_start'])+'-'+str(change_df.iloc[het_list[n]]['c_end'])+\ str(change_df.iloc[het_list[n]]['c_content'])) # if(change_df.iloc[i]['mutation_type'].find('del')!=-1): # shift-=(int(change_df.iloc[i]['c_end'])-int(change_df.iloc[i]['c_start'])+1) # elif(change_df.iloc[i]['mutation_type'].find('ins')!=-1): # shift+=(int(change_df.iloc[i]['c_end'])-int(change_df.iloc[i]['c_start'])+1) het_des.append(tmp_het_des) for j in range(n, len(het_list)): tmp_new_sequence = new_sequence tmp_new_des = tmp_het_des if (j != n): if (abs( int(change_df.iloc[het_list[j]] ['c_start']) - splicing_position) <= 900): if ((int(change_df.iloc[het_list[j]] ['c_start']) >= coding_start - 1) & (int(change_df.iloc[het_list[j]] ['c_start']) <= coding_end)): if (strand_dict[key] == '-'): tmp_new_sequence=generate_all_mutation_db.change_seq(tmp_new_sequence,int(change_df.iloc[het_list[j]]['c_start'])+shift,\ int(change_df.iloc[het_list[j]]['c_end'])+shift,\ str(Seq(str(change_df.iloc[het_list[j]]['c_content'])).complement()),\ change_df.iloc[het_list[j]]['mutation_type']) else: tmp_new_sequence=generate_all_mutation_db.change_seq(tmp_new_sequence,int(change_df.iloc[het_list[j]]['c_start'])+shift,\ int(change_df.iloc[het_list[j]]['c_end'])+shift,change_df.iloc[het_list[j]]['c_content'],\ change_df.iloc[het_list[j]]['mutation_type']) tmp_new_des.append(change_df.iloc[het_list[j]]['mutation_type']+":"+\ str(change_df.iloc[het_list[j]]['c_start'])+'-'+str(change_df.iloc[het_list[j]]['c_end'])+\ str(change_df.iloc[het_list[j]]['c_content'])) het_des.append(tmp_new_des) if (strand_dict[key] == '+'): new_seq = tmp_new_sequence else: new_seq = str( Seq(str(tmp_new_sequence), IUPAC.ambiguous_dna). complement()) het_seqs.append(new_seq) for c in range( 0, len(het_seqs) ): ##tmp_cnt is the number of modified sequences tmp_seq = het_seqs[c] if ((high_index - low_index) == 1): position = tmp_exon_position_dict[low_index][1] if (position >= coding_start): db_seq = tmp_seq[coding_start - 1:] if (db_seq not in trans_db_annotation_dict.keys()): trans_db_annotation_dict[db_seq] = [ key, str(k) + "_exclusive_from_" + str(position - coding_start + 1) ] else: des_tmp = str( k) + "_exclusive_from_" + str( position - coding_start + 1) if (des_tmp not in trans_db_annotation_dict[db_seq]): trans_db_annotation_dict[ db_seq].append(des_tmp) tmp_anno = "" for d in hom_des: tmp_anno += d for d in het_des[c]: tmp_anno += d trans_db_annotation_dict[db_seq].append( tmp_anno) #tmp_info=exon_coordinate_dict[skip_id] tmp_skip_id_index = generate_all_se_db.find_key_index( 'exon_id', skip_id, trans_records) tmp_info=(trans_records.iloc[tmp_skip_id_index]['chr'],trans_records.iloc[tmp_skip_id_index]['start'],\ trans_records.iloc[tmp_skip_id_index]['end']) skip_seq = generate_all_se_db.fetch_exon_seq( tmp_info[0], tmp_info[1], tmp_info[2], T[0]) trans_prime_seq = generate_all_se_db.add_exon( tmp_seq, skip_seq, position) db_prime_seq = trans_prime_seq[coding_start - 1:] if (db_prime_seq not in trans_db_annotation_dict.keys()): trans_db_annotation_dict[db_prime_seq]=[key,"modified_"+str(k)+"_inclusive_from_"\ +str(position-coding_start+1)+"_to_"+\ str(position-coding_start+1+len(skip_seq))] else: des_tmp="modified_"+str(k)+"_inclusive_from_"+\ str(position-coding_start+1)+"_to_"+\ str(position-coding_start+1+len(skip_seq)) if (des_tmp not in trans_db_annotation_dict[ db_prime_seq]): trans_db_annotation_dict[ db_prime_seq].append(des_tmp) tmp_anno = "" for d in hom_des: tmp_anno += d for d in het_des[c]: tmp_anno += d trans_db_annotation_dict[db_prime_seq].append( tmp_anno) elif (T[low_index + 1] == skip_id): skip_exon_start = tmp_exon_position_dict[low_index + 1][0] skip_exon_end = tmp_exon_position_dict[low_index + 1][1] if (skip_exon_start >= coding_start): db_seq = tmp_seq[coding_start - 1:] if (db_seq not in trans_db_annotation_dict.keys()): trans_db_annotation_dict[db_seq]=[key,str(k)+"_inclusive_from_"+str(skip_exon_start-coding_start+1)\ +"_to_"+str(skip_exon_end-coding_start+1)] else: des_tmp=str(k)+"_inclusive_from_"+str(skip_exon_start-coding_start+1)\ +"_to_"+str(skip_exon_end-coding_start+1) if (des_tmp not in trans_db_annotation_dict[db_seq]): trans_db_annotation_dict[ db_seq].append(des_tmp) tmp_anno = "" for d in hom_des: tmp_anno += d for d in het_des[c]: tmp_anno += d trans_db_annotation_dict[db_seq].append( tmp_anno) trans_prime_seq = generate_all_se_db.remove_exon( tmp_seq, skip_exon_start, skip_exon_end) db_prime_seq = trans_prime_seq[coding_start - 1:] if (db_prime_seq not in trans_db_annotation_dict.keys()): trans_db_annotation_dict[db_prime_seq] = [ key, "modified_" + str(k) + "_exclusive_from_" + str(skip_exon_start - coding_start + 1) ] else: des_tmp="modified_"+str(k)+"_exclusive_from_"+\ str(skip_exon_start-coding_start+1) if (des_tmp not in trans_db_annotation_dict[ db_prime_seq]): trans_db_annotation_dict[ db_prime_seq].append(des_tmp) tmp_anno = "" for d in hom_des: p = get_variant_pos_from_des(d) if p not in range(skip_exon_start, skip_exon_end): tmp_anno += d for d in het_des[c]: p = get_variant_pos_from_des(d) if p not in range(skip_exon_start, skip_exon_end): tmp_anno += d trans_db_annotation_dict[db_prime_seq].append( tmp_anno) if ((len(hom_position_list) == 0) and (len(het_list) == 0)): coding_start = trans_coding_dict[key][0] tmp_exon_coordinate_dict = {} tmp_exon_position_dict = {} tmp_pos = 0 for item in range(1, len(T)): ei = generate_all_se_db.find_key_index( 'exon_id', T[item], trans_records) if (ei == -1): print("the exon id cannot be found") else: tmp_start = trans_records.iloc[ei]['start'] tmp_end = trans_records.iloc[ei]['end'] tmp_exon_coordinate_dict[T[item]] = ( trans_records.iloc[ei]['chr'], tmp_start, tmp_end) tmp_exon_position_dict[item] = (tmp_pos, tmp_pos + tmp_end - tmp_start + 1) tmp_pos += tmp_end - tmp_start + 1 if ((high_index - low_index) == 1): position = tmp_exon_position_dict[low_index][1] if (position >= coding_start): db_seq = tmp_seq[coding_start - 1:] if (db_seq not in trans_db_annotation_dict.keys()): trans_db_annotation_dict[db_seq] = [ key, str(k) + "_exclusive_from_" + str(position - coding_start + 1) ] else: des_tmp = str(k) + "_exclusive_from_" + str( position - coding_start + 1) if (des_tmp not in trans_db_annotation_dict[db_seq]): trans_db_annotation_dict[db_seq].append( des_tmp) tmp_skip_id_index = generate_all_se_db.find_key_index( 'exon_id', skip_id, trans_records) tmp_info=(trans_records.iloc[tmp_skip_id_index]['chr'],trans_records.iloc[tmp_skip_id_index]['start'],\ trans_records.iloc[tmp_skip_id_index]['end']) skip_seq = generate_all_se_db.fetch_exon_seq( tmp_info[0], tmp_info[1], tmp_info[2], T[0]) trans_prime_seq = generate_all_se_db.add_exon( tmp_seq, skip_seq, position) db_prime_seq = trans_prime_seq[coding_start - 1:] if (db_prime_seq not in trans_db_annotation_dict.keys()): trans_db_annotation_dict[db_prime_seq]=[key,"modified_"+str(k)+"_inclusive_from_"\ +str(position-coding_start+1)+"_to_"+\ str(position-coding_start+1+len(skip_seq))] else: des_tmp="modified_"+str(k)+"_inclusive_from_"+\ str(position-coding_start+1)+"_to_"+\ str(position-coding_start+1+len(skip_seq)) if (des_tmp not in trans_db_annotation_dict[ db_prime_seq]): trans_db_annotation_dict[ db_prime_seq].append(des_tmp) elif (T[low_index + 1] == skip_id): skip_exon_start = tmp_exon_position_dict[low_index + 1][0] skip_exon_end = tmp_exon_position_dict[low_index + 1][1] if (skip_exon_start >= coding_start): db_seq = tmp_seq[coding_start - 1:] if (db_seq not in trans_db_annotation_dict.keys()): trans_db_annotation_dict[db_seq]=[key,str(k)+"_inclusive_from_"+str(skip_exon_start-coding_start+1)\ +"_to_"+str(skip_exon_end-coding_start+1)] else: des_tmp=str(k)+"_inclusive_from_"+str(skip_exon_start-coding_start+1)\ +"_to_"+str(skip_exon_end-coding_start+1) if (des_tmp not in trans_db_annotation_dict[db_seq]): trans_db_annotation_dict[db_seq].append( des_tmp) trans_prime_seq = generate_all_se_db.remove_exon( tmp_seq, skip_exon_start, skip_exon_end) db_prime_seq = trans_prime_seq[coding_start - 1:] if (db_prime_seq not in trans_db_annotation_dict.keys()): trans_db_annotation_dict[db_prime_seq] = [ key, "modified_" + str(k) + "_exclusive_from_" + str(skip_exon_start - coding_start + 1) ] else: des_tmp="modified_"+str(k)+"_exclusive_from_"+\ str(skip_exon_start-coding_start+1) if (des_tmp not in trans_db_annotation_dict[ db_prime_seq]): trans_db_annotation_dict[ db_prime_seq].append(des_tmp) trans_records = trans_records.sort_values(by=['trans_id']) my_seqs = [] # my_transcripts=[] modified_trans = [] mutation_seq_cnt = 0 for k in trans_db_annotation_dict.keys(): annotation_list = trans_db_annotation_dict[k] trans_id = annotation_list[0] modified_trans.append(trans_id) #coding_start=trans_coding_dict[trans_id][0] #print(trans_id) pid = protein_id_dict[trans_id][0] gid = protein_id_dict[trans_id][1] tmp_id = db + "|" + pid + '|' + trans_id + '|' + gid des = '' flag = 0 for an in range(1, len(annotation_list)): if (annotation_list[an].find('snv') != -1): flag = 1 des += annotation_list[an] + '|' # my_transcripts.append(SeqRecord(Seq(str(k),IUPAC.ambiguous_dna),id=tmp_id,description=des)) if (flag == 1): mutation_seq_cnt += 1 new_seq = str( Seq(str(k), IUPAC.ambiguous_dna).transcribe().translate(to_stop=True)) while (new_seq.find('None') != -1): new_seq = new_seq.replace('None', '') my_seqs.append( SeqRecord(Seq(str(new_seq), IUPAC.protein), id=tmp_id, description=des)) print("The number of sequences with mutation generated is " + str(mutation_seq_cnt)) if (exclude != True): original_cnt = 0 for t in trans_seq_dict.keys(): if t not in modified_trans: coding_start = int(trans_coding_dict[t][0]) coding_end = int(trans_coding_dict[t][1]) trans_seq = str(trans_seq_dict[t]) trans_seq = trans_seq[coding_start - 1:] if (trans_seq not in trans_db_annotation_dict.keys()): pid = protein_id_dict[t][0] gid = protein_id_dict[t][1] new_sequence = trans_seq new_seq = str( Seq(str(new_sequence), IUPAC.ambiguous_dna).transcribe().translate( to_stop=True)) # else: # new_seq=str(Seq(str(new_sequence),IUPAC.ambiguous_dna).complement().transcribe().translate(to_stop=True)) my_seqs.append(SeqRecord(Seq(str(new_seq),IUPAC.protein),\ id=db+'|'+pid+'|'+t+'|'+gid+'_0:'+str(coding_start)+'-'+str(coding_end),\ description="no splicing")) original_cnt += 1 print("The number of original sequences is " + str(original_cnt)) print("The number of sequences generated is " + str(len(my_seqs))) handle = open(output_name + ".fasta", "w") #handle=open(dataset_name+"_all_se_db"+".fasta","w") for sequence in my_seqs: SeqIO.write(sequence, handle, "fasta") handle.close() # handle_trans=open("../data/"+dataset_name+"/"+dataset_name+"_all_se_transcripts"+".fasta","w") # for sequence in my_transcripts: # SeqIO.write(sequence,handle_trans,"fasta") # handle_trans.close() #return my_seqs #dbname="../data/gencode.v28.basic.annotation.gff3" #SE_name=argv[1] #dfname=argv[2] #rna_db=argv[3] #output_name=argv[4] # #df_SE=pd.read_csv(SE_name,sep='\t') #generate_se_sequence_combination(df_SE,dfname,dbname,rna_db,output_name) ## #finish=time.time() #print("---- %s minutes ----" % ((finish-begin)/60))
# 4.4.9.orf_finder.py from Bio.Seq import Seq tatabox_seq = Seq("tataaaggcAATATGCAGTAG") start_idx = tatabox_seq.find("ATG") end_idx = tatabox_seq.find("TAG", start_idx) # 예문의 편의상 TAG 로 하였다. orf = tatabox_seq[start_idx:end_idx + 3] # 파이썬 문자열과 같은 방법으로 슬라이싱이 가능하다. print(orf) # ATGCAGTAG
def get_new_sequence(dfname, dbname, rna_db, het, exclude, output_name): version = get_version(rna_db) if (version == 'swissprot'): db = 'sp' else: db = version sequence_dict = {} rna_seq = SeqIO.parse(rna_db, 'fasta') ##check the correctness of rna-seqs for correct in rna_seq: tmp = correct.id flag = tmp.find("|") tmp = tmp[flag + 1:] cds = tmp.find('CDS:') if (cds == -1): print("The format of file of parameter -r(--rna) is incorrect!") return 0 tmp = tmp[cds:] cds_end = tmp.find('|') tmp = tmp[tmp.find(':') + 1:cds_end] split_flag = tmp.find('-') if (split_flag == -1): print("The format of file of parameter -r(--rna) is incorrect!") return 0 rna_seqs = SeqIO.parse(rna_db, 'fasta') for seq in rna_seqs: tmp = seq.id flag = tmp.find("|") mrna_id = tmp[:flag] tmp = tmp[flag + 1:] cds = tmp.find('CDS:') tmp = tmp[cds:] cds_end = tmp.find('|') tmp = tmp[tmp.find(':') + 1:cds_end] split_flag = tmp.find('-') coding_start = int(tmp[:split_flag]) coding_end = int(tmp[split_flag + 1:]) sequence_dict[mrna_id] = (coding_start, seq.seq, coding_end) print("sequence_dict ready") records = DataIterator(dbname) strand_dict = {} protein_id_dict = {} for record in records: if (record[2] == 'transcript'): if ('transcript_type' in record.attributes): if (record.attributes['transcript_id'][0] in sequence_dict.keys()): strand_dict[record.attributes['transcript_id'] [0]] = record[6] protein_id_dict[record.attributes['transcript_id'][0]]=(record.attributes['protein_id'][0],\ record.attributes['gene_id'][0]) print("protein_id_dict ready") df = pd.read_csv(dfname, sep='\t', header=None) change_df = extract_transcript_change(df) trans_index_dict = {} for i in range(0, change_df.shape[0]): if (change_df.iloc[i]['mrna'] not in trans_index_dict.keys()): trans_index_dict[change_df.iloc[i]['mrna']] = [i] else: trans_index_dict[change_df.iloc[i]['mrna']].append(i) my_seqs = [] k_cnt = 0 hom_only_cnt = 0 hom_het_cnt = 0 het_only_cnt = 0 original_cnt = 0 random_cnt = 0 for k in trans_index_dict.keys(): if (k in protein_id_dict.keys()): k_cnt += 1 if (k_cnt % 1000 == 0): print(k_cnt) pid = protein_id_dict[k][0] gid = protein_id_dict[k][1] if (strand_dict[k] == '+'): transcript = str(sequence_dict[k][1]) else: tmp = Seq(str(sequence_dict[k][1]), IUPAC.ambiguous_dna).complement() transcript = str(tmp) coding_start = int(sequence_dict[k][0]) - 1 coding_end = int(sequence_dict[k][2]) - 1 transcript = transcript[coding_start:coding_end + 1] shift = 0 des = "" het_list = [] hom_position_list = [] for i in trans_index_dict[k]: if (change_df.iloc[i]['snp_type'] == 'hom'): hom_position_list.append( (int(change_df.iloc[i]['c_start']), change_df.iloc[i]['mutation_type'])) # if(change_df.iloc[i]['mutation_type']=='snv'): # transcript=change_seq(transcript,int(change_df.iloc[i]['c_start'])+shift,\ # int(change_df.iloc[i]['c_end'])+shift,change_df.iloc[i]['c_content'],'snv') # des+="snv:"+str(change_df.iloc[i]['c_start'])+change_df.iloc[i]['c_content']+'_' # else: if (strand_dict[k] == '-'): transcript=change_seq(transcript,int(change_df.iloc[i]['c_start'])+shift,\ int(change_df.iloc[i]['c_end'])+shift,str(Seq(str(change_df.iloc[i]['c_content'])).complement()),\ change_df.iloc[i]['mutation_type']) else: transcript=change_seq(transcript,int(change_df.iloc[i]['c_start'])+shift,\ int(change_df.iloc[i]['c_end'])+shift,change_df.iloc[i]['c_content'],\ change_df.iloc[i]['mutation_type']) des+=change_df.iloc[i]['mutation_type']+":"+str(change_df.iloc[i]['c_start'])+'-'+\ str(change_df.iloc[i]['c_end'])+str(change_df.iloc[i]['c_content'])+'_' if (change_df.iloc[i]['mutation_type'].find('del') != -1): shift -= (int(change_df.iloc[i]['c_end']) - int(change_df.iloc[i]['c_start']) + 1) elif (change_df.iloc[i]['mutation_type'].find('ins') != -1): shift += (int(change_df.iloc[i]['c_end']) - int(change_df.iloc[i]['c_start']) + 1) else: het_list.append(i) if (len(hom_position_list) != 0): new_sequence = "" new_des = "" for p in hom_position_list: flag = des.find(str(p[0])) tmp = des[flag:] flag = tmp.find('_') new_des += str(p[1]) + ":" + tmp[:flag + 1] new_sequence = transcript if (len(new_sequence) != 0): new_sequence = new_sequence[shift:] if (strand_dict[k] == '+'): new_seq = str( Seq(str(new_sequence), IUPAC.ambiguous_dna).transcribe().translate( to_stop=True)) else: new_seq = str( Seq(str(new_sequence), IUPAC.ambiguous_dna). complement().transcribe().translate(to_stop=True)) while (new_seq.find('None') != -1): new_seq = new_seq.replace('None', '') my_seqs.append(SeqRecord(Seq(str(new_seq),IUPAC.protein),\ id=db+'|'+pid+'|'+k+'|'+gid+'_0:'+str(int(sequence_dict[k][0])+shift)+'-'+str(int(sequence_dict[k][2])+shift)+'_'+new_des,\ description=new_des)) hom_only_cnt += 1 else: if (exclude == False): new_sequence = transcript if (strand_dict[k] == '+'): new_seq = str( Seq(str(new_sequence), IUPAC.ambiguous_dna).transcribe().translate( to_stop=True)) else: new_seq = str( Seq(str(new_sequence), IUPAC.ambiguous_dna). complement().transcribe().translate(to_stop=True)) my_seqs.append(SeqRecord(Seq(str(new_seq),IUPAC.protein),\ id=db+'|'+pid+'|'+k+'|'+gid+'_0:'+str(int(sequence_dict[k][0]))+'-'+str(int(sequence_dict[k][2]))+'_no_variant',\ description="no variant")) original_cnt += 1 if (het == 1): coding_start = int(sequence_dict[k][0]) + shift - 1 coding_end = int(sequence_dict[k][2]) + shift - 1 count = int(len(transcript) / 900) if (len(transcript) <= 900): count = 1 cnt = 0 for l in range(0, count): l = l * 900 start = l if (start + 1799 < len(transcript)): stop = start + 1799 else: stop = len(transcript) - 1 het_number = len(het_list) for n in range(0, het_number): new_sequence = "" new_des = "" if ((int(change_df.iloc[het_list[n]]['c_start']) >= start) & (int(change_df.iloc[het_list[n]]['c_start']) <= stop)): if (strand_dict[k] == '-'): new_sequence=change_seq(transcript,int(change_df.iloc[het_list[n]]['c_start'])+shift,\ int(change_df.iloc[het_list[n]]['c_end'])+shift,\ str(Seq(str(change_df.iloc[het_list[n]]['c_content'])).complement()),\ change_df.iloc[het_list[n]]['mutation_type']) else: new_sequence=change_seq(transcript,int(change_df.iloc[het_list[n]]['c_start'])+shift,\ int(change_df.iloc[het_list[n]]['c_end'])+shift,change_df.iloc[het_list[n]]['c_content'],\ change_df.iloc[het_list[n]]['mutation_type']) new_des=des+change_df.iloc[het_list[n]]['mutation_type']+":"+\ str(change_df.iloc[het_list[n]]['c_start'])+'-'+str(change_df.iloc[het_list[n]]['c_end'])+\ str(change_df.iloc[het_list[n]]['c_content']) if (len(new_sequence) != 0): new_sequence = new_sequence[start:stop + 1] if (strand_dict[k] == '+'): new_seq = str( Seq(str(new_sequence), IUPAC.ambiguous_dna ).transcribe().translate(to_stop=True)) else: new_seq = str( Seq(str(new_sequence), IUPAC.ambiguous_dna).complement(). transcribe().translate(to_stop=True)) cnt += 1 while (new_seq.find('None') != -1): new_seq = new_seq.replace('None', '') my_seqs.append(SeqRecord(Seq(str(new_seq),IUPAC.protein),\ id=db+'|'+pid+'|'+k+'|'+gid+'_'+str(cnt)+':'+str(start+1)+'-'+str(stop+1)+'_'+new_des,\ description=new_des)) if (len(hom_position_list) != 0): hom_het_cnt += 1 else: het_only_cnt += 1 if (change_df.iloc[het_list[n]]['mutation_type'] == 'snv'): random_seq, random_des = generate_random_SNV_site( strand_dict[k], k, transcript[start:stop + 1], int(change_df.iloc[het_list[n]]['c_start']) - start) my_seqs.append(SeqRecord(Seq(str(random_seq),IUPAC.protein),\ id=db+'|'+pid+'|'+k+'|'+gid+'_'+str(cnt)+':'+str(start+1)+'-'+str(stop+1)+'_'+des+random_des,\ description=des+random_des)) random_cnt += 1 else: random_seq,random_des=generate_random_fs(strand_dict[k],transcript[start:stop+1],\ change_df.iloc[het_list[n]]['mutation_type'],\ len(change_df.iloc[het_list[n]]['c_content']),\ int(change_df.iloc[het_list[n]]['c_start'])-start) # if(len(random_seq)!=0): my_seqs.append(SeqRecord(Seq(str(random_seq),IUPAC.protein),\ id=db+'|'+pid+'|'+k+'|'+gid+'_'+str(cnt)+':'+str(start+1)+'-'+str(stop+1)+'_'+des+random_des,\ description=des+random_des)) random_cnt += 1 if (exclude == False): for key in sequence_dict.keys(): if (key not in trans_index_dict.keys()): pid = protein_id_dict[key][0] gid = protein_id_dict[key][1] coding_start = int(sequence_dict[key][0]) - 1 coding_end = int(sequence_dict[key][2]) - 1 new_sequence = sequence_dict[key][1][coding_start:coding_end + 1] new_seq = str( Seq(str(new_sequence), IUPAC.ambiguous_dna).transcribe().translate( to_stop=True)) my_seqs.append(SeqRecord(Seq(str(new_seq),IUPAC.protein),\ id=db+'|'+pid+'|'+key+'|'+gid+'_0:'+str(coding_start+1)+'-'+str(coding_end+1)+'_no_variant',\ description="no variant")) original_cnt += 1 print("The number of proteins related is " + str(k_cnt)) print("The number of sequences generated is " + str(len(my_seqs))) handle = open(output_name + ".fasta", "w") for sequence in my_seqs: SeqIO.write(sequence, handle, "fasta") print("The number of sequences containing hom only is " + str(hom_only_cnt)) print("The number of sequences containing het only is " + str(het_only_cnt)) print("The number of mixed sequences is " + str(hom_het_cnt)) print("The number of original sequences is " + str(original_cnt)) print("The number of random sequences is " + str(random_cnt))
from Bio.Seq import Seq from Bio.Alphabet import generic_dna from Bio.Alphabet import generic_rna from Bio.Alphabet import generic_protein my_dna = Seq("ATGGGGAGAAGGCCGTAG", generic_dna) #print my_dna #a = my_dna + 'aaa' #print a print my_dna.find('AGG') print my_dna.find('AGA') print my_dna print my_dna.count('A') print len(my_dna) your_dna = my_dna.complement() print your_dna my_rna = my_dna.transcribe() print my_rna my_protr = my_rna.translate(table=1, to_stop=True) #table = 1 is default std genetic code, http://www.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi#SG1 #to_stop=True tells it to stop at stops print my_protr my_protd = my_dna.translate(to_stop=True) print my_protd #playing with complete CDS' #yaaX = Seq("GTGAAAAAGATGCAATCTATCGTACTCGCACTTTCCCTGGTTCTGGTCGCTCCCATGGCA" + \
def import_excel_view(request): #define function called 'import_excel_view' new_line_char = "--" new_line = 0 #Adds a new line character between uploaded file information when new_line > 0 if request.method == "POST": #if there is data to be submitted continue with script form1 = UploadFileForm(request.POST, request.FILES) form2 = RefForm(request.POST) form3 = ChrLocForm(request.POST) #handles assigned to user submitted data for each form. ValidForm1 = False #Grants entry into oligo search loop if True if form1.is_valid() and (form2.is_valid() or form3.is_valid()): #Validates user input for oligo files and at least one reference check = (form2.is_valid()), (form3.is_valid()) if form1.is_valid() and all(check): raise forms.ValidationError('OOPS! You submitted two types of reference data. Either paste your reference or identify a chromosome location.') #Raises error if there is user input for both references #SUBMITTED DATA: OLIGO FILE if form1.is_valid(): oligo_input = request.FILES.getlist('file') #Accesses 'file' from match_oligo/forms.py and uses .getlist to access all items in the MultiValueDict name_match_list = [] sheet_info_list = [] reference_info = [] #creates empty list where matches from all files will be stored ValidForm1 = True #Grants entry into oligo search loop if True #SUBMITTED DATA: REFERENCE PASTE if form2.is_valid(): reference = form2.cleaned_data['reference'] #accesses validated form input #reference = request.POST['reference'] #access unvalidated form input reference_upper = reference.upper().replace(" ", "") ref_seq = Seq(reference_upper) #uses biopython to convert reference into Seq object ref_rev_comp = Seq.reverse_complement(ref_seq) #uses biopython to create a reverse compliment of the submitted reference data ref_length = str(len(ref_seq)) reference_info.extend(("The following number of nucleotides were searched: {}".format(ref_length),)) chr_input_seq = '' chr_input_rev_seq = '' #create empty list of UCSC das url reference variables to prevent error in oligo search loop #SUBMITTED DATA: UCSC DAS URL REFERENCE elif form3.is_valid(): chrom = request.POST['chr'] loc_start = request.POST['loc_start'] loc_stop = request.POST['loc_stop'] #access user input for chromsome location url = "http://genome.ucsc.edu/cgi-bin/das/hg19/dna?segment=chr{}:{},{}".format(chrom, loc_start, loc_stop) chr_url = urllib.request.urlopen(url) chr_url_read = chr_url.read() chr_url_decode = chr_url_read.decode('utf-8') #open, read, and decode text from the UCSC das url chr_input = re.sub('<.+>', '', chr_url_decode) chr_input_strip = chr_input.replace('\n','') chr_input_caps = chr_input_strip.upper().replace(" ", "") #remove all non-sequence text between <>, remove newline, and convert to all caps chr_input_seq = Seq(chr_input_caps) #use biopython to create sequence object out of url text chr_input_rev_seq = Seq.reverse_complement(chr_input_seq) #use biopython to create reverse compiment of sequence reference_info.extend(("Chromosome {}: {}-{}".format(chrom,loc_start,loc_stop),)) reference_info.extend(("{}".format(url),)) ref_seq = '' ref_rev_comp = '' #create empty list of paste reference variables to prevent error in oligo search loop if ValidForm1: #ValidForm1 is True if form1 (excel oligo input) is valid for xlsfile in oligo_input: #iterates through user uploaded files if new_line > 0: name_match_list.extend((new_line_char,)) #adds new line character if a file already had a match (new_line > 0) new_line = 0 #reset- if a file does not have a match a new line character will not be added for next file saw_file = 0 #reset- if first time seeing a file (saw_file = 0) name of file will be displayed oligo_row = 0 oligo_col = 2 name_col = 0 #variables assigned to row and columns of excel input and needs to be reset for each file book = xlrd.open_workbook(file_contents=xlsfile.read()) #Uses xlrd package to open and read submitted file as excel sheet. #Creates string from 'ExcelInMemoryUploadedFile' with read() function. sheet = book.sheet_by_index(0) #identifies which sheet in the excel file to use nrows = sheet.nrows #sets handle to number of rows in identified excel sheet sheet_info_list.extend(("{}".format(xlsfile),)) sheet_info_list.extend(("Sheet: {}".format(sheet.name),)) sheet_info_list.extend(("Total number of oligos searched: {}".format(sheet.nrows),)) sheet_info_list.extend((new_line_char,)) #displays each of the excel file's information for oligo in range(sheet.nrows): #iterates through items in identified file/sheet cell = sheet.cell_value(rowx=oligo_row, colx=oligo_col) #using above variables, sets handle to the cell in the current sheet/file where match search will begin #OLIGO MATCH SCRIPT: add +1 to oligo_row until reach nrows (ie the total number of rows in the sheet) if oligo_row < nrows: oligo_caps = cell.upper().replace(" ", "") oligo_find = ref_seq.find(oligo_caps) oligo_rev_find = ref_rev_comp.find(oligo_caps) oligo_find_url = chr_input_seq.find(oligo_caps) oligo_rev_find_url = chr_input_rev_seq.find(oligo_caps) #uses biopython to look for oligo in reference and reverse compliment of reference if oligo_find == -1 and oligo_find_url == -1 and oligo_rev_find == -1 and oligo_rev_find == -1 or cell == '': oligo_row += 1 #if there is no match (-1), go to next row (add +1 to oligo_row) elif oligo_find != -1 or oligo_find_url != -1 or oligo_rev_find != -1 or oligo_rev_find_url != -1: #if there is a match (not -1, any other number is the index of the match), set handle to that cell name name = sheet.cell_value(rowx=oligo_row, colx=name_col) #assign handle to cell with match name_match = str(name) #create string from cell name if saw_file < 1: xls_match_file_name = "%s:" % xlsfile name_match_list.extend((xls_match_file_name,)) name_match_list.extend((name_match,)) #if first time seeing a match in file (saw_file = 0) name of file and match will be displayed else: name_match_list.extend((name_match,)) #if file already has a match (saw_file > 0) match will be be displayed saw_file += 1 oligo_row += 1 new_line += 1 return render(request, 'match_oligo/output.html', {'var': name_match_list, 'search_param': sheet_info_list, 'ref_info': reference_info}) else: form1 = UploadFileForm() form2 = RefForm() form3 = ChrLocForm() return render(request, 'match_oligo/user_input.html', {'form1': form1, 'form2': form2, 'form3':form3})
search_seq = Column[2] #identifies column with oligo sequence (2 is actually 3 because numbering starts at 0) full_name = Column[1] #identifies column with oligo names (1 is actually 2 because numbering starts at 0) oligo_key = Column[0] #identifies column with oligo identifier eg KH23 (0 is actually 1 because numbering starts at 0) matching_search = Seq(CAPS_reference_seq) #opens BioPython's Seq function on reference file and names it reverse_compliment = matching_search.reverse_complement() #creates a BioPython matching search for the reverse compliment of the reference file oligo_find = matching_search.find(search_seq) #Uses find function to search for oligos in reference file reverse_oligo_find = reverse_compliment.find(search_seq) #Uses find function to search for oligos in reverse compliment of reference file if oligo_find != -1 : #if the results is not -1 then move on with the script. -1 means failure or there was no match. if oligo_find != 0 : #if the result is not 0 then move on with the script OutputString = ("Here is the location oligo name and the location: %s, %s \n" % (oligo_key, oligo_find)) #defines the oligos that pass the above tests or match to the reference file OutFile2.write(OutputString)