def __str__(self):
"""
Give the HGVS description of the raw variant stored in this class.
:returns unicode: The HGVS description of the raw variant stored in
this class.
"""
if self.type == 'unknown':
return '?'
if self.type == 'none':
return '='
if self.count > 0:
return '{0}({1})'.format(self.inserted, self.count)
description = str(self.start)
if self.start != self.end:
description += '_{0}'.format(self.end)
if self.type != 'subst':
description += str(self.type)
if self.type in ('ins', 'delins'):
return description + str(self.inserted)
elif self.type == 'struct':
return str(self.inserted)
return description
return description + '{0}>{1}'.format(self.deleted, self.inserted)
def __str__(self):
"""
Give the HGVS description of the raw variant stored in this class.
:returns unicode: The HGVS description of the raw variant stored in
this class.
"""
if self.type == 'unknown':
return '?'
if self.type == 'none':
return '='
description = str(self.start)
if self.start != self.end:
description += '_{0}'.format(self.end)
if self.type != 'subst':
description += str(self.type)
if self.type in ('ins', 'delins'):
return description + str(self.inserted)
return description
return description + '{0}>{1}'.format(self.deleted, self.inserted)
def __str__(self):
"""
Give the HGVS description of the raw variant stored in this class.
:returns unicode: The HGVS description of the raw variant stored in
this class.
"""
# TODO: ext*
if self.type == 'unknown':
return '?'
if self.type == 'none':
return '='
description = '{}{}'.format(seq3(self.start_aa), self.start)
if self.term:
return description + '{}fs*{}'.format(
seq3(self.inserted[0].sequence[0]), self.term)
if self.start != self.end:
description += '_{}{}'.format(seq3(self.end_aa), self.end)
if self.type != 'subst':
description += self.type
if self.type in ('ins', 'delins'):
return description + seq3(str(self.inserted)) # FIXME: str
return description
return description + seq3(self.inserted)
def test1(self):
"""
Test 1.
"""
result = describe_dna('ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA',
'ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA')
assert str(result) == '[5_6insTT;17del;26A>C;35dup]'
def test4(self):
"""
Test 4.
"""
result = describe_dna(
'TAAGCACCAGGAGTCCATGAAGAAGATGGCTCCTGCCATGGAATCCCCTACTCTA',
'TAAGCACCAGGAGTCCATGAAGAAGCCATGTCCTGCCATGAATCCCCTACTCTA')
assert str(result) == '[26_29inv;30C>G;41del]'
def test2(self):
"""
Test 2.
"""
result = describe_dna(
'TAAGCACCAGGAGTCCATGAAGAAGATGGCTCCTGCCATGGAATCCCCTACTCTACTGTG',
'TAAGCACCAGGAGTCCATGAAGAAGCTGGATCCTCCCATGGAATCCCCTACTCTACTGTG')
assert str(result) == '[26A>C;30C>A;35G>C]'
def test1(self):
"""
Test 1.
"""
result = describe_dna(
'ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA',
'ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA')
assert str(result) == '[5_6insTT;17del;26A>C;35dup]'
def test4(self):
"""
Test 4.
"""
result = describe_dna(
'TAAGCACCAGGAGTCCATGAAGAAGATGGCTCCTGCCATGGAATCCCCTACTCTA',
'TAAGCACCAGGAGTCCATGAAGAAGCCATGTCCTGCCATGAATCCCCTACTCTA')
assert str(result) == '[26_29inv;30C>G;41del]'
def test2(self):
"""
Test 2.
"""
result = describe_dna(
'TAAGCACCAGGAGTCCATGAAGAAGATGGCTCCTGCCATGGAATCCCCTACTCTACTGTG',
'TAAGCACCAGGAGTCCATGAAGAAGCTGGATCCTCCCATGGAATCCCCTACTCTACTGTG')
assert str(result) == '[26A>C;30C>A;35G>C]'
def nhgvs(self):
"""
"""
if self.type == 'unknown':
return '?'
if self.type == 'none':
return '='
description = str(self.start)
if self.start != self.end:
description += '_{}'.format(self.end)
if self.type != 'subst':
description += self.type
if self.type in ('ins', 'delins'):
return description + str(self.inserted)
return description
return description + '{}>{}'.format(self.deleted, self.inserted)
def nhgvs(self):
"""
"""
if self.type == 'unknown':
return '?'
if self.type == 'none':
return '='
description = str(self.start)
if self.start != self.end:
description += '_{}'.format(self.end)
if self.type != 'subst':
description += self.type
if self.type in ('ins', 'delins'):
return description + str(self.inserted)
return description
return description + '{}>{}'.format(self.deleted, self.inserted)
def _single_variant(self, sample, expected):
"""
General single variant test.
"""
description = describe.describe_protein(self.reference, sample)
assert description[0].type == expected[0]
assert description[0].start == expected[1]
assert description[0].end == expected[2]
assert description[0].sample_start == expected[3]
assert description[0].sample_end == expected[4]
assert description[0].deleted[0].sequence == expected[5]
assert description[0].inserted[0].sequence == expected[6]
assert str(description[0]) == expected[7]
def _single_variant(self, sample, expected):
"""
General single variant test.
"""
reference = 'ACGTCGATTCGCTAGCTTCGGGGGATAGATAGAGATATAGAGAT'
result = describe_dna(reference, sample)
assert result[0].type == expected[0]
assert result[0].start == expected[1]
assert result[0].end == expected[2]
assert result[0].sample_start == expected[3]
assert result[0].sample_end == expected[4]
assert result[0].deleted[0].sequence == expected[5]
assert result[0].inserted[0].sequence == expected[6]
assert str(result[0]) == expected[7]
def _single_variant(self, sample, expected):
"""
General single variant test.
"""
reference = 'ACGTCGATTCGCTAGCTTCGGGGGATAGATAGAGATATAGAGAT'
result = describe_dna(reference, sample)
assert result[0].type == expected[0]
assert result[0].start == expected[1]
assert result[0].end == expected[2]
assert result[0].sample_start == expected[3]
assert result[0].sample_end == expected[4]
assert result[0].deleted[0].sequence == expected[5]
assert result[0].inserted[0].sequence == expected[6]
assert str(result[0]) == expected[7]
def __str__(self):
if len(self.items) > 1:
return '[{0}]'.format(';'.join(map(str, self.items)))
return str(self.items[0])
def __str__(self):
if len(self.items) > 1:
return '[{0}]'.format(';'.join(map(str, self.items)))
return str(self.items[0])
